The Unz Review • An Alternative Media Selection$
A Collection of Interesting, Important, and Controversial Perspectives Largely Excluded from the American Mainstream Media
 PodcastsKevin Barrett Archive
Random or Designed? COVID Origin and Evolution “Conspiracy Theories”
Email This Page to Someone

 Remember My Information



=>

Bookmark Toggle AllToCAdd to LibraryRemove from Library • B
Show CommentNext New CommentNext New ReplyRead More
ReplyAgree/Disagree/Etc. More... This Commenter This Thread Hide Thread Display All Comments
AgreeDisagreeThanksLOLTroll
These buttons register your public Agreement, Disagreement, Thanks, LOL, or Troll with the selected comment. They are ONLY available to recent, frequent commenters who have saved their Name+Email using the 'Remember My Information' checkbox, and may also ONLY be used three times during any eight hour period.
Ignore Commenter Follow Commenter
Search Text Case Sensitive  Exact Words  Include Comments
List of Bookmarks

Did COVID-19 jump from animals to humans due to random mutations? Or was a bat coronavirus deliberately tweaked to infect humans via gain-of-function research? The topic has been hotly debated since January 2020. But the debate was suppressed by the world’s most powerful institutions, including the medical and scientific establishments and the media, until May 2021, when suddenly it emerged as a legitimate topic of mainstream discourse.

When one compares the human pathogen SARS-CoV-2 to its bat-infecting relatives, one notices features that at first glance seem engineered. The most obvious is the spike protein that functions as a key to unlock the human cell. The odds that such a perfect “key” to a very complex “lock” would emerge naturally out of random processes might seem, at first glance, prohibitively low. To quantify the odds, one would have to know how many random mutations would have to occur to transform the key to bat cells into a key to human cells. One would also have to know the combinatorial space determining the odds that each mutation could enhance the virus’s prospects of building a key for unlocking human cells. Finally, the odds of each “beneficial” mutation’s happening to work well with other such mutations would need to be calculated.

Once we had a working idea of the probability of a human-cell-opening spike protein emerging through random mutations, we would then need to figure out how many chances the mutating virus would have had to practice its improving skills on human cells. To simplify: If the odds of a randomly-generated human-affecting spike protein emerging are one in a million, we would expect that it would take about a million bat virus contacts with human cells before one of them got lucky. We could then assess the likelihood of so many contacts occurring. If that likelihood was low enough, we could discount the natural-emergence hypothesis.

The problem of determining whether COVID-19 is random or designed parallels the larger and more difficult problem debated by neo-Darwinians and their critics: Is life itself random or designed? After reading Stephen C. Meyer’s Darwin’s Doubt: The Explosive Origin of Animal Life and the Case for Intelligent Design, I wouldn’t be surprised if the media and scientific experts eventually come around, as they have in the case of COVID-19, to admitting that case for design is not a fully-debunked “conspiracy theory” believed only by obscurantists and quacks, Trump voters and religious fundamentalists, and so on, but is, on the contrary, supported by surprisingly strong evidence.

The basic problem in the evolution debate, as in the COVID origins debate, boils down to the question: Can random processes generate information? And if so, can they generate enough information to explain the phenomenon under investigation—whether it’s the origin of COVID or the origin and development of life on earth? Those responding negatively to Darwinism ground their arguments in probability theory and its cousin, information theory, as explained in the Hoover Institution video Mathematical Challenges to Darwin.

Their opponents, seemingly reluctant to debate on mathematical grounds, fling ad hominems and non sequiturs, obfuscations and diversions, mischaracterizations and stale bromides…and when all else fails, threats to reputations and employment prospects. In other words, the pro-Darwinism camp behaves like the supporters of the orthodox narratives of World War II, the JFK assassination, 9/11, Zionism, and other sensitive political issues. That in itself ought to be enough to make any fair-minded observer suspicious.

Now that the debate over COVID origins has been deemed permissible by our oligarchical overlords, we can envision a thought experiment: What if those arguing against the lab emergence hypothesis refused to debate the issue on its merits, but instead insisted that any claim that COVID was intelligently designed was inherently unscientific? That, in effect, is the main argument the neo-Darwinians use against the likes of Stephen C. Meyer. They claim that Meyer’s intelligent design hypothesis violates the precept of methodological naturalism: the insistence that science must restrict itself to investigating material causes of natural phenomena. Methodological naturalism is, of course, tautological: If we arbitrarily call something a natural phenomenon, and then restrict ourselves to naturalistic/materialistic explanations, we have illicitly evaded i.e. begged the question of whether or not it was intelligently designed. Invoking methodological naturalism to delegitimize debate is the same sort of question-begging trick used by supporters of political orthodoxy when they arbitrarily deem an argument, hypothesis, or field of inquiry “conspiracy theory” or “denial” in order to avoid having to defend their own indefensible position.

Those who support a robust debate over COVID origins, but see no reason to debate Darwin, might argue that methodological naturalism is well-suited to the latter but not the former. After all, we can easily envision how COVID might have been cooked up in a lab. The techniques are well-known. The existence of hundreds of biowar labs is a given. But we have no way of similarly envisioning what might have happened when life on Earth first emerged from a pre-biotic environment (the topic of Meyer’s earlier book Signature in the Cell). Nor can we easily imagine precisely how a Designer would have caused animals to suddenly appeared fully formed with no apparent evolutionary antecedents during the Cambrian explosion (the lynchpin of Darwin’s Doubt).

Such arguments, ironically enough, mirror the much-derided “God of the gaps” fallacy—only in this case, it’s the “Darwin of the gaps” fallacy. Actually, two fallacies are on display: the argument from ignorance (“we don’t know that God or ETs or extradimensionals seeded life on Earth 3.5 billion years ago and then came back and created animals 541 million years ago, so therefore it didn’t happen”) and the argument from incredulity (“I can’t imagine how an intelligent designer could have created life and then animals, and it violates my deep-seated belief in Darwinism, so therefore it didn’t happen.”) Once we dispel these fallacies, we see that there is no more reason to arbitrarily exclude the intelligent design hypothesis for the origin and development of life in general than for the origin and development of COVID-19. In both cases, we are looking at something that might or might not be an artifact, that may or may not be the product of a mind. And in both cases, much of the evidence in dispute involves mathematical probabilities. Some of it needs to be elucidated by specialists before non-specialists can even begin to form an opinion. But perhaps not all of it.

Ron Unz has written a series of articles arguing that COVID-19 emerged from a US biological warfare strike against China and Iran. Much of the evidence he cites is circumstantial. But circumstantial evidence can be quite strong: What are the odds that COVID-19 would first emerge at the worst possible place and time for China (Wuhan on Chinese New Year) and next migrate to Qom to incapacitate or kill a substantial fraction of Iran’s ruling elite? What are the odds that this would randomly happen at the peak of neocon-driven US 4th generation wars on China and Iran? What are the odds that this “randomly mutated virus” would turn out to be a perfect anti-economy bioweapon, hitting the “sweet spot” combining ultra-contagiousness with the requisite .5% to 1% lethality? What are the odds that a US military games team would have shown up in Wuhan at the exact moment COVID was first unleashed? And above all, what are the odds that the US Defense Intelligence Agency would just happen to issue a strongly-worded warning to guard against an impending pandemic in Wuhan more than one month before anyone else on Earth, least of all the Chinese government, knew of any such outbreak?

If we consider the wider context, the “coincidences” pile up even further: What are the odds that all of these random occurrences would perfectly mimic what we would expect from a US biological attack on China’s economy? What are the odds that such a perfect natural imitator of a biowar virus would show up in China at the precise moment in history when a pre-emptive US attack on China’s economy would seem almost inevitable to students of geopolitical history and the Thucydides Trap?

It is impossible to precisely quantify the odds against these and other items Unz cites being a series of mere coincidences. We must fall back on our respective intuitive evaluations. To me, it seems intuitively obvious that Unz is almost certainly right, or at least largely right. But what is obvious to me is apparently less so to others. To me, the circumstances of Lee Harvey Oswald’s murder by mobster Jack Rubenstein, and the subsequent cover-up, make it obvious that JFK was killed by a high-level conspiracy. To me, the obvious demolition of WTC-7 obviously demolishes the official story of 9/11. To me, Sen. Paul Wellstone’s plane crash at a pivotal moment in history, shortly after he was issued a draconian threat by Dick Cheney, was obviously a case of murder. If you notice the obvious in such cases, much less belabor it, you’ll be called a conspiracy theorist—while those who don’t notice it blithely go about their business.

Similarly, it is intuitively obvious to me that the world in general and life in particular is not just filled with, but consists of, order and meaning, and as such is obviously the product of mind. I don’t really need Stephen C. Meyer to explain to me why the odds of a randomly-mutated DNA sequence coding for a useful protein that could play a role in a beneficial mutation are so prohibitively low that the whole Darwinian paradigm collapses. (Meyer doesn’t deny microevolution, the fitness-driven changes within single populations, but rather argues that the extremely low odds of randomly-mutated DNA leading to beneficial outcomes demolishes the neo-Darwinian macroevolutionary paradigm.)

When we encounter phenomena that strike us as exceedingly unlikely to have occurred by chance, we intuitively sense a mind at work. Meyer cites the case of the Eastern Island statues: Though we have no idea who made them or how they were made, we attribute them to human minds and hands. The theoretical possibility that random geological and meteorological processes produced them barely occurs to us, because it seems so unlikely.

Likewise, a string of improbable “coincidences” like those involved in the Wuhan COVID outbreak, the JFK and Wellstone assassinations, 9/11, and so on, can sometimes strongly suggest that the phenomenon was produced by human minds, which can imaginatively reach into the future and act in such a way as to produce objects and events that would almost certainly never have occurred by chance.

Can intuitive assessments of such things have any value? Consider the game of chess: Humans play chess using mostly intuitive understandings, rather than explicit calculations, of how future sequences of moves will play out. A chess player who intuits that a given move is the best option can check his intuition by running a computer program that will explicitly chart out the possible future sequences of moves.

In somewhat similar fashion, those of us who ponder whether COVID-19, and life itself, are intelligently-designed artifacts can check our intuitions by turning to specialists capable of supplementing our evaluations with quantitative precision. So just as I can predict that a computer analysis will bear out the strength of a chess move, without being able to perform that analysis on paper, so too can I predict that sooner or later the work of specialists will confirm the hypotheses that COVID-19 was made in a lab and that life on Earth has been shaped by intelligent design.

 
Hide 225 CommentsLeave a Comment
Commenters to Ignore...to FollowEndorsed Only
Trim Comments?
    []
  1. R2b says:

    In the theory that no virus has ever been isolated, and then made to produce a disease, lies the fact of different causes, to what we, by studying symptoms, call a flu.

    A yearly flu has what causes?
    Well we look at the debris, and draw conclusions, but never adhere to Koch’s postulates.
    There are certainly causes that can increase flu-symptoms, that are not acknowledged, or sufficiently studied.

    And on the other side, the tests, PCR or antibody, of which none tells us about the actual facts.
    Short, we lack basic cause and effect.

    Yes God created, as said in Genesis, and the only comparison with this, as the article ponders, is that sure, an evil entity can have, in certain instances, created a poison, that is ”designed”/created a substance, to boost the yearly influenza.

    You really have no scientific right, to say more than that.

    • Replies: @HorstG
    , @GomezAdddams
    , @Leo Den
  2. Notsofast says:

    great article, i have always found it interesting that the people of the stem religion cannot see the devine nature of the living planet that they inhabit. the darwinists can see the mechanism of natural selection but not the purpose of it. call her gaia or better yet call her maya for the whole of the cosmos is a state of consciousness and we use the same equipment to process our waking “reality” as we do to process our dream consciousness.

    • Thanks: Stonehands, St-Germain
  3. IvyMike says:

    It’s quite likely the spike mutation was present in the Corona virus population before it came into contact with humans, that is how evolution works, a new niche and a candidate ready to fill it. You have to admire how, in only a year, evolution has led to several more efficient variants.
    I don’t discount the possibility of it coming from a lab, but this article falsely describes the working of evolution to make it seem impossible for Covid to have come about naturally. But when was journalism ever anything but a jumble of lies?

    • Replies: @Dumbo
    , @Rev. Spooner
  4. I am a PhD physicist who is co-inventor on various patents involving applications of information theory. My wife is a PhD biologist.

    If the IDers had a mathematical argument that was not obviously wrong, a lot of us in the scientific community would be willing to hear it.

    Unfortunately, for way too many decades they have been spouting so much nonsense that, yes, they are now discredited.

    Why don’t we engage them? Over the years we have gotten tired of wasting our time.

    And, no, complex organisms did not start in the Cambrian.

  5. SND says:

    I watched the embedded Hoover Institution video a couple years ago & thought, “Hey this Stephen Meyer guy sounds pretty interesting.” So I got his (now) three books & read them all. I cannot recommend them highly enough. And I was raised & remain an atheist! Doesn’t matter. Meyer’s beautiful arguments are a thought provoking pleasure to read. He’s a hero, taking on the immense Darwinian scientific establishment practically single-handedly.

    Yes, Kevin Barrett, that does kind of remind one of Ron Unz. And just like Unz, Meyer is completely ignored.

    So, here’s the deal. We all know Jeff Bezos is heading into space. But no one is telling the real reason. The reason is that he’s trying to find the secret nest of malignant neo-con gods who for their own nefarious purposes declared war on the universe by manufacturing & seeding planet Earth with the deadly virus – life.

    If Bezos finds them & uncovers the origin of their dastardly plans he’ll report back to Stephen Meyer, who’ll then report back to Ron & the circle will be complete.

    • Replies: @Rahan
  6. Dumbo says:
    @IvyMike

    this article falsely describes the working of evolution to make it seem impossible for Covid to have come about naturally.

    It was already proven by several studies that “evolution” (if it really works in the way people think it works, as I don’t think so) by itself was likely not responsible for the Covid virus mutations, as it would require much more time than it did.

    You have to admire how, in only a year, evolution has led to several more efficient variants.

    No, you have to admire how propaganda so quickly convinced people of that.

    It’s quite likely the spike mutation was present in the Corona virus population before it came into contact with humans,

    All coronaviruses have a spike protein, but the Covid one shows a very likely possibility of human manipulation.

    that is how evolution works, a new niche and a candidate ready to fill it.

    Evolution even according to Darwin is random and has no purpose. I don’t see how viruses would see “a new niche” and “fill it” by mutating. Actually I don’t think viruses work this way at all. There’s a lot about them that we don’t know.

    • Replies: @anon
  7. dimples says:

    This article seems more like a random mess rather than the product of intelligent design. If SARS2 was intelligently designed, this disproves the theory of evolution. And it’s only a short step from there to belief in Allah and that UFOs are demons!

    • Disagree: Ukraine Tiger
  8. dimples says:

    Isn’t it the Gnostic view that the Universal Designer created a random mess by mistake and then had to create humans in order to figure it all out for him?

  9. onebornfree says: • Website

    “Did COVID-19 jump from animals to humans due to random mutations? Or was a bat coronavirus deliberately tweaked to infect humans via gain-of-function research? ”

    There is no Covid-19 virus, nor any other type of virus. The entire field of virology is a fraud:

    “THE FINAL REFUTATION OF VIROLOGY” (Dr. Stefan Lanka – 2021):


    Regards, onebornfree

    • Thanks: R2b, BuelahMan
    • Replies: @Iva
    , @Dave Bowman
  10. @PhysicistDave

    In the video posted in the article, and elsewhere, David Berlinski (among others) argues, quite reluctantly, that Meyer’s mathematical arguments seem obviously right. Can you point me to a good summary of a strong argument to the contrary?

  11. Rahan says:
    @SND

    We all know Jeff Bezos is heading into space. But no one is telling the real reason.

    To fake his tragic death, of course.
    He and Gates divorced their wives in preparation, because within a year or two it will turn out their circle engineered some very very nasty events.
    So the wives are preemptively divorced in order to focus the hatred only on the leading visible men, and these men themselves will all have terrible accidents happen to them, or develop cancer etc, and “disappear”. Thus only lower tier jerks will get to pay the price.
    How’s that for a conspiracy…:D

    • Replies: @Fred777
  12. R2b says:
    @PhysicistDave

    That’s just what it was. Complexity.
    And it is a layer, not a an earlier strata.
    Lyell was just projecting theory.
    The great thing with what was named Cambrium, is that it contrary to darwinist theory, was full of complexity. The smallest life-forms, with splendid functions.
    Actually, the findings in Cambrian layers are the absolute proof of creation ex nihilo, because there are no precedents to these perfect little creatures.

    • Replies: @PhysicistDave
  13. Sean says:

    Likewise, a string of improbable “coincidences” .

    To evaluate the improbableness of an occurrence, one must begin by asking “What is the reference class?” The Wuhan Institute of Virology is a leading world center for research on coronaviruses and perhaps the premier one for research into bat coronaviruses. It was being funded to research potential pandemic bat coronaviruses and as part of that work it was creating new and especially virulent human coronaviruses. If the pandemic was caused by the deliberate use of a bioweapon then Wuhan was chosen because per a ‘lab accident’, it provided an explanation for such a high degree of human–human transmissibility. The pandemic pathogen having just jumped out of a bat is not very probable.

    The basic problem in the evolution debate, as in the COVID origins debate, boils down to the question: Can random processes generate information?

    Nicholas Wade has said “the idea that the virus might have escaped from a lab invoked accident, not conspiracy”.

    Published: 27 March 2013
    H5N1 viral-engineering dangers will not go away
    Simon Wain-Hobson
    Nature volume 495, page411 (2013)
    Governments, funders and regulatory authorities must urgently address the risks posed by gain-of-function research, says Simon Wain-Hobson.

    In a Nature editorial (that should give one an idea of his Everest like standing in the field of microbiology) seven years before the current Covid pandemic Simon Wain-Hobson raised prescient awareness of the escape of an artificially and deliberately enhanced pathogen.

    “Rather than use the avian flu moratorium to seek advice, listen and foster debate, many influenza scientists engaged in an academic exercise of self-justification,” Wain-Hobson, then chair of the Foundation for Vaccine Research in Washington, DC, explained in a remarkably-prescient 2013 Nature editorial. “It is too easy for scientists in a field to dismiss criticism and ideas from outside.”

    Just how well Wain-Hobson understood the lust for glory of certain microbiologists was shown in 2015 when University of North Carolina microbiology professor, Ralph Baric and researchers including Wuhan researchers Xing-Yi Ge and Zhengli-Li Shi, used sophisticated techniques to create a coronavirus with extraordinary infectiousness in humans. “In order to study it in a lab, scientists have created a hybrid version of a virus that could be the world’s next pandemic — a SARS 2.0,” Vice Magazine reported. This was in 2015 remember. Wain-Hobson, criticized the manufacture of a new virus that “grows remarkably well” in the cells of humans. “If the virus escaped, nobody could predict the trajectory,” he said. Fauci may have helped lift a Gain Of Function ban in 2017.

    Wuhan Institute of Virology (WIV), in conjunction with Dr. Peter Daszak’s EcoHealth Alliance which was funded by the U.S. National Institutes of Health (Director:Anthony Stephen Fauci). EcoHealth Alliance also got funded by the Pentagon, to the tune of$39 million. Just months before the pandemic started, Daszak made some statements implicating Wuhan and his collaboration with and funding of it in gain of function bat coronaviruses .

    In 2017, US diplomats were told about potential pandemic coronaviruses being worked on in Wuhan and rapidly and ordered check on whether the facility was operating appropriate to the level of containment The final US safety-check visit was after the BSL-4 lab in Wuhan was being used in Jan 2018, and US experts reported biosafety standards were not being met in practice.

    JFK and Wellstone assassinations, 9/11, and so on, can sometimes strongly suggest that the phenomenon was produced by human minds, which can imaginatively reach into the future and act in such a way as to produce objects and events that would almost certainly never have occurred by chance.

    For assassination, all you need are the bullets and the balls. Texan ex-marines are not short of either.

    Can intuitive assessments of such things have any value? Consider the game of chess: Humans play chess using mostly intuitive understandings, rather than explicit calculations, of how future sequences of moves will play out. A chess player who intuits that a given move is the best option can check his intuition by running a computer program that will explicitly chart out the possible future sequences of moves.

    I take a different view of chess; to me it is very unlike the real world inasmuch chess is where the information is all there and the problem is to work through it like a computer, which is why a computer can beat a human at chess. Also, opponents are known to be such because that is inherent in the rules. But in the real world we never have complete information because the real world is where uncertainty reigns about the facts, and the intentionality of other people. I think what you are trying to do is reason as if you know others malevolent and have secret motives. Rather than tie it all together, just concentrate on one case and prove you are right about it.

  14. @Kevin Barrett

    Frankly I stopped watching when Gelernter (giving the lie to his nomen)
    showed abject incomprehension of “species”; three joos devoid of a whiff arguing in bad faith – trying to hit my toes with a hammer is a more edifying use of my time.

    – I recommend Heinrich K. Erben´s (“Intelligenzen im Kosmos“) putdown of the used-up “Green Banks Formula”. Juggling “probabilities” we have no way of knowing
    is a wee bit below counting angels dancing on a pinhead. And just as the only ones slobbering about ETs are astrophysicists who wouldn´t recognize a living system if it shit them in the face, the only “anti-Darwinists” are “bioinformatics” and “information theory” fuzzies
    (I refuse to call them “mathematicians” as these usually know their limits, and I explicitly exempt Manfred Eigen who had the understanding).
    Leave that crap to the Real McCoys – paleontologists.

    The argument that G-d created fossils (and radioactive daughters) to lead astray the feeble-minded was last raised in earnest ~400 years ago (outside the US, that is).
    The “Gaia” hypothesis – in the sense of Life´s role in terraforming and planetary homoiostasis – is by and large accepted (at least from ~2Ga, “primary soda ocean”-> oxyatmoversion/banded iron formation and oldest recorded glaciation).
    There has been life for as long as there are oceans, or ~4.3Ga; the interesting part is for 2/3 of that it was prokaryotic. The step from eukaryota (1.4Ga) to metazoa (~720Ma) took a lot less (!).
    The “Cambrian Explosion” is an artefact of the Snowball Earth and a single enzyme allowing direct biomineralization i.e. hard shells.

    – Mr. Unz´ideas are plausible – motive, opportunity, “coincidences” – but do not,
    as such, rise above “working hypothesis”; the military games are an argument against –
    there are simpler and less obtrusive ways of planting a virus near a cooperating lab.
    Not a virologist, I understand the reproductive cycle is peculiarly open to gene shuffling –
    and refuse to jump to conclusions one way or another.

    • Replies: @Huskynut
    , @skrik
  15. ebear says:

    “Can random processes generate information?”

    Who says they’re random? Can we even define random?

    There’s nothing random about a water molecule. Hydrogen and oxygen always combine in a 2 to 1 ratio. Nothing random about that. The same is true of all molecules and the elements of which they’re composed. They all combine in deterministic patterns, which while they may be complex, are certainly not random.

    So why is it hard to believe that the same determinism isn’t present in higher level biological structures? They clearly behave in non-random ways or life wouldn’t be possible, so why wouldn’t the process by which they first emerged and then evolved also be deterministic? That we haven’t as yet identified the mechanism doesn’t mean it doesn’t exist – just that we haven’t identified it, in the same sense that we lack a complete unified theory of matter.

    I see the creationist vs natural selection argument as a false dichotomy. A more interesting question is why are matter and energy organized the way they are? Who ordered that?

  16. thordaddy says:

    Naturally evolving vs man-made bioweapon is a false dichotomy.

    All the evidence, or, lack thereof, suggests a “virtual virus.”

    The viral effect of mass hysteria and mob action are crucial redistribution and depopulation mechanisms.

  17. @Kevin Barrett

    Kevin Barrett wrote to me:

    In the video posted in the article, and elsewhere, David Berlinski (among others) argues, quite reluctantly, that Meyer’s mathematical arguments seem obviously right.

    Berlinski may pretend that he is quite reluctant, but he is a very well-known longtime supporter of Intelligent Design. Yes, yes I know his coy little game of claiming he is not really one of them but he just cannot help agreeing with them. His coy little game has now been going on for a very long time.

    Kev also asked:

    Can you point me to a good summary of a strong argument to the contrary?

    Well, let me explain the situation: a large number of us natural scientists have spent many, many hours trying to address the IDers. Most of us have come to realize that it is just a waste of time. They and their fans will not listen.

    Life is short.

    So we have generally concluded that we should just tell anyone who is sincerely interested to go to the effort to learn the relevant biology, chemistry, paleontology, and probability theory, and then they will know that the IDers’ nonsense is indeed nonsense.

    Against my better judgment, I will briefly mention one of the most common mistakes made by the IDers.

    Donald Trump’s victory in 2016 was a surprise. I gave him a 1 in 3 chance of winning, about the same as the odds given by Nate Silver. So, while it was a surprise to Silver and me, it was not that big of a surprise: 1 in 3 events happen a lot..

    But now consider the odds that Trump would get exactly the popular vote totals in each of the 50 states that he actually got. There are so many possible state-level totals that the odds of getting exactly those vote totals in each state was not even one in a googol.

    Wow! A miracle! How amazing that Trump got exactly the vote totals he got!

    Do you see the error here? No matter what Trump’s vote totals in each state, even if he had lost, getting the exact vote totals he received had a probability of almost zero.

    But that means nothing. Almost any very specific course of events in the real world has an almost zero chance of occurring. Nonetheless, something is going to happen.

    You have to be very, very careful in using probabilistic reasoning to avoid this sort of fallacy.

    The IDers are generally not careful.

    A related point: suppose you could prove that there is only a 1 in ten trillion chance that life could arise on an earth-like planet. We know now that there are probably trillions and trillions of earth-like planets in the observable universe. On all the would-be earths on which life did not evolve, there is no one there to observe this fact. Necessarily, the planets on which there are animals to observe the existence of life happen to be one of the rare planets on which life evolved.

    Am I saying that Berlinksi, Gelernter, and Meyer are idiots? I am far too polite to say that.

    Let’s just say that when Gelernter started off describing all three as scientists, he was not telling the truth. Berlinski has a Ph.D. in philosophy. Gelernter is a computer scientist: “computer science” is to science as “political science” is to science. Steve Meyer has a PhD in the History and Philosophy of Science. Just as a historian of medicine is not a physician (don’t let him take out your appendix!), so also a historian of science is not a scientist.

    This sort of, let us call it “misdirection,” is typical of the ID movement.

    Gelernter is also wrong in saying there is very little dispute about the distinction between species: this betrays an incredible ignorance of the biological and paleontological literature.

    I am more than willing to criticize real shortcomings of my fellow scientists: I have been very critical over the decades of the over-hyping of the danger of global warming. I have said from early on that the lab-leak hypothesis for Covid is more than plausible. I was even critical of the traditional approach to quantum mechanics that prevailed back in my student days.

    But the IDers? They have played too many games to be taken seriously any longer by scientists.

    We are just no longer willing to take them seriously or play their games.

    • Thanks: Sean
    • Replies: @Kevin Barrett
  18. @R2b

    R2b wrote to me:

    Actually, the findings in Cambrian layers are the absolute proof of creation ex nihilo, because there are no precedents to these perfect little creatures.

    You are mistaken. Radically mistaken.

    Google “Ediacaran.”

    • Replies: @R2b
  19. It may be more a question of unintelligent design since the intelligent has capitulated and gone off on their own.

  20. cranc says:

    What are the odds that this “randomly mutated virus” would turn out to be a perfect anti-economy bioweapon, hitting the “sweet spot” combining ultra-contagiousness with the requisite .5% to 1% lethality?

    The 1% IFR was made up from thin air last year when people like Ron Unz were reflexively quoting it, and it is still wrong now. All serious science points to an IFR of ~0.2% to 0.25%, with a very heavy weighting toward those over 70 years old.

    How is this a “sweet spot” ? Is there literature which demonstrates design of pathogens with these characteristics developed with the intent of economic damage?
    How does targetting the elderly damage an economy?

    The narrative cope of a bioweapon attack by the US deep state upon China to ‘cripple its economy’ leads to a series of obvious questions and thoughts : China has benefitted from the pandemic everyone else has suffered, China it is said ‘controlled the virus’ because ‘it got lockdown right when everyone else got it wrong’, therefore we are to believe that lockdown works, but only if enacted in the most draconian an authoritarian manner.
    The upshot of the Unz/ Barrett theory is ‘lockdown again and lockdown harder’.

    Those of us who disagree see lockdowns as having caused a significant proportion of the excess deaths this last 15 months. Michael Senger makes a reasonable estimate at 164,000 lockdown deaths in the US in 2020 – this of course a drop in the ocean compared to the effects upon developing nations.
    Proponents of lockdown (which incidentally is a policy with one singular source -i.e. CCP; NB it was never before regarded as effective or in keeping with medical ethics) are knowingly or not advocating mass murder. And it is disproportionately younger people who die as a consequence of lockdowns.

    The story here is not the origin of the virus or the time of its emergence. It is the suspension of the economy, the transferrance of wealth and control, and the timing of those developments.

    • Agree: theMann
  21. HorstG says:
    @R2b

    German here. It’s Stefan Lanka, who challenges the virus science, by own lab experiments and in court. He states the virology is about looking at debris. My point here, I want to show something big may be staged. He just gave a speech on stage, at a demonstration in Nürnberg. The historical place, think Nürnberg trail and code. The demonstration was organized by QUERDENKEN-911 Nürnberg. Not kidding, they got that number, there is a website. On YT, his speech can be found: “Dr. Stefan Lankas Molekularbiologe Demo Nürnberg Querdenken-911 vom 15.05.21” He announces, big change is just around the corner, the virus theory would fall in court soon. 119 has history in Germany, fall of the Berlin wall, 1938, 1923, 1918.

    • Thanks: R2b
  22. Huskynut says:
    @nokangaroos

    Do you turn yourself on by spouting science-babble whilst stroking your own ego?

  23. The strongest evidence goes to motivation-a bio-warfare attack on an enemy is PRECISELY what you would expect the Evil, psychopathic, US ruling class to do.

    • Replies: @The Real World
  24. @Sean

    Anyone who believes ‘US experts’ defaming target countries, is a sucker. Or is patsy, or rube better?

    • Replies: @Sean
  25. skrik says:
    @nokangaroos

    Mr. Unz´ideas are plausible – motive, opportunity, “coincidences” – but do not, as such, rise above “working hypothesis”; the military games are an argument against – there are simpler and less obtrusive ways of planting a virus near a cooperating lab.
    Not a virologist,

    … nor am I, rather an interested observer.

    1st, I don’t think that the ID and SARS-CoV-2 cases are comparable; ID requires some other-worldly = ‘supernatural’ intelligence existing beyond matter, a concept I reject on at least two grounds both based on the conservation ‘laws’ [here = matter (photons, electrons, protons & neutrons plus the whole quark zoo etc.) can neither be created nor destroyed], a) our current universe began with the ‘big bang’ which was a) *not* a creation event but ‘merely’ a phase-change from super-dense via a super-hot moment [conceptionally like pressurised super-heated water flashing over to steam on pressure-reduction] to expanding/cooling, then b) no ‘external agency, supernatural or not’ can manipulate matter, summarised as no external intelligence, no mechanism = no ID [plus no ‘creator’ as a ‘bonus’]. IMHO, IF there are ‘gaps’ in the evolutionary record THEN not looking hard enough.

    2nd to CoV-2, enough of the pieces have now been identified to show lab-made; the spike is a chimera based on bat RaTG13 with the RBD of pangolin MP789 plus the PRRA ‘polybasic cleavage site’ off-frame insertion with the curious CGG-CGG codons. I offer as a piece of proof the EVALI events; the symptoms remarkably resemble those of COVID-19 [refer to ground-glass-like X-ray images, say], but without apparent transmissibility. I suggest that EVALI was a test-run via contaminated e-device input fluid. After confirming the lab-made chimera’s effects [the chimera most likely sourced via WIV], the PRRA was crudely shoved in and the final product released – by some covert black-hats.

    Some brief discussion: It has been said that the military games would not be an optimal method of release, but the same type of argument is used by lab-made deniers, that the *critical* for infection but odd PRRA would not be a designer’s choice. But WYSIWYG; Occam’s razor suggests adding the least complications, better none. As to the remote possibility that the chimera arose ‘naturally’ via recombination, kindly note that for that to happen, a CoV-sick bat would have to meet a differently Cov-sick pangolin, any recombination would have to occur in a cell infected by both CoVs then the product would have to endure before being zoonotically passed to some human patient-0. IMHO that’s just too big an ‘ask.’

    As an interested observer I report facts as I find them, and on principle do not argue with those facts. rgds

    • Agree: Mulga Mumblebrain
    • Replies: @nokangaroos
    , @dimples
  26. Wielgus says:

    https://en.wikipedia.org/wiki/Ayta%C3%A7_Yalman

    Senior Turkish army general – among other things he conducted a crackdown on left-wing prisoners in Turkey, killing 28 of them, in the year 2000. He visited Iran in February 2020 and became one of the first to die of Covid in Turkey when he returned there. The virulence of Covid in Iran does indeed suggest some sort of targeting, so not a natural outbreak. Given his rank, Yalman may well have picked up the illness from targeted Iranian dignitaries he met in Iran.
    At 79 he was also in the most vulnerable age range for Covid. If Covid was engineered it may have been deliberately designed to take out older people as these tend to be high-ups in a lot of regimes the Yank does not like.

  27. What is problematic about the attempts to make a “probability” argument against evolution is that the universe is a huge sample space. If it could be verified that somewhere off in another galaxy there are people who routinely fly back and forth between different planets a la Luke Skywalker & Han Solo then it would make some sense to shift to something like the “Chariot of the Gods” where life on earth is simply the result of aliens having visited here a long time ago. If there were parts of the universe where intelligent life easily springs into being then this would be a reasonable hypothesis.

    But even if we take the view (which seems plausible) that intelligent life, and even life itself, is very rare in the universe then the bigness of the universe is still an issue with these probabilistic arguments against evolution. Given the vast expanse of the universe, saying that there is a low probability of life as we know it on earth evolving anywhere just means that the earth may well be an isolated case seated against a vast panorama of a dead cosmos. It doesn’t tell us anything much about the merits of any specific theory about the evolution of life on earth.

    To put it another way, if you could fill the universe up with different individuals who all come equipped with a penny and are assigned to throw that penny a million times while listing the result of heads or tails, then one of them would surely manage to throw a million heads in a row. It’s doubtful that any of us would ever manage to throw even a hundred heads in a row, but that’s because we don’t spend enough time trying to do it. If there were an infinite, uncountable set of people all across the cosmos throwing pennies to record the result then someone, somewhere probably would get the desired outcome.

  28. anon[177] • Disclaimer says:
    @Dumbo

    Creationist lies are so often parroted that they’ve been sorted and indexed into a long list. Yours in particular are indexed under Creationist Claim CA620 and Claim CB940.

    Index to Creationist Claims
    http://talkorigins.org/indexcc/list.html

    • Replies: @Dumbo
    , @R2b
  29. Deliberate tinkering of deadly coronaviruses? NO WAY…but you can bet your bippy US/western entities have been patenting them since probably before 2003 (which would have been during the BushCo Darth Cheney era, coincidently)

    From the memory hole:

    Scientists race to patent SARS virus
    Researchers around the world are racing to patent the SARS virus and its genetic material, rekindling criticism of laws that allow people to claim intellectual property rights on living things.

    Oct. 15, 2003, 6:24 PM EDT / Source: The Associated Press

    https://www.nbcnews.com/id/wbna3076748

    And for the patent lawyers, and advocates/activists for access to low cost essential medicines for 3rd World countries, (like Dr. Carlo Urbani, the heroic 1999 Nobel prize sharing MsF doctor, who was regrettably struck down by SARS1 in early 2003; see Wikipedia) out there, here is a 2004, 40 page legal paper:

    THE RACE TO PATENT THE SARS VIRUS:
    THE TRIPS AGREEMENT AND ACCESS TO ESSENTIAL MEDICINES

    https://law.unimelb.edu.au/__data/assets/pdf_file/0007/1681117/Rimmer.pdf

  30. @Kevin Barrett

    Being a helpful fellow, I did a bit of googling and here is one reference that lays out some of the errors the IDers are making: see especially Section 3. As the references in that paper indicate, there has been a great deal of work on this: the IDers just do not care.

    I know a decent amount about this: my wife is a biologist, and I have actually helped her analyze evolutionary changes in amino-acid sequences in proteins. A key point is that making one change in an amino-acid sequence often produces another functional protein. Evolution does not usually (or almost ever) create a brand-new protein de novo that is chosen randomly from the huge space of possible proteins. But that is what the IDers are mistakenly assuming in their calculation.

    You yourself have a number of proteins with sequences that differ from the majority of human beings in at least one amino acid: that is just another way of saying that we are different genetically (yeah, there are differences in control sequences too). Evolutionary molecular biologists can go on and on about how there are protein families that have gradually diverged from a common ancestor, with later proteins often carrying out very different functions.

    And then there is the issue of gene duplication, which allows an extra copy that is free to undergo random mutations that sort of wander around in protein hyperspace.

    And then there is evo-devo and the homeobox and the fact that to change a sheep into a cat you use pretty much the same proteins with some rather small changes in the control sequences. Gelernter seems not to know this either.

    The IDers could learn about all this… if they cared. But that would take work and would show them that what they are selling is just snake oil.

    And so they do not.

    Not very admirable human beings.

    Anyway, hope this is informative to some people reading this. Of course, any IDer reading this just won’t care.

  31. John Hagan says: • Website

    Tumour: A ‘body’ can be 99 percent healthy yet one cancerous cell can cause much damage growing into a tumour. Although it realizes that by destroying the very body it feeds on it is also destroying itself yet that end does not prevent its greed for reproduction. Most US citizens are well aware where the tumour lies and its progress.
    For those who have the interest I made a short video illustrating the thesis above regarding the possibility that US is suffering a malignant tumour in three areas.The three areas are the war machine, wall street, education

  32. Anon[193] • Disclaimer says:

    In other words, the pro-Darwinism camp behaves like the supporters of the orthodox narratives of World War II, the JFK assassination, 9/11, Zionism, and other sensitive political issues. That in itself ought to be enough to make any fair-minded observer suspicious.

    In other words…

    Jews again. Same tactics, same stupidity, same evil.

    Jews.

    Time for a vaccine against them.

  33. Sean says:
    @Mulga Mumblebrain

    He is world famous as the sequencer of HIV

    In his talk Simon Wain-Hobson explains among other things the results of selective screening of ferrets that were deliberately infected with viruses and compares them to the likely evolution by natural selection. He elucidates the transferability of findings to other virus strains and the limits of animal models. Wain-Hobson points out risks as well as benefits from this kind of research like pandemic preparedness by predicting influenza evolution or the ability of making and stockpiling drugs. He also discusses if these theoretical benefits correspond to recent experiences in science and medicine.

    Link to most relevant: Barrett’s point about nature

    • Replies: @Mulga Mumblebrain
  34. @PhysicistDave

    Unfortunately, for way too many decades they have been spouting so much nonsense that, yes, they are now discredited.

    So, “too many decades” of independent thought to suit the modern grant-driven campus clique and their sacred repository of superior knowledge that may not be questioned? Decades indeed! Have you and your wife ever heard of an ancient society that denied the existence of the spiritual world?
    .
    Your five-paragraph argument from authority obviously hasn’t debunked or discredited anything. But it has ducked the core issue raised by Kevin Barrett and convincingly laid out in mathematics by Stephen Meyer and other ID writers.

    Please share a few of your consensus relevations on what lesser mortals ought to believe about neo-Darwinism. Or will it bet just another distillation of snide comments popularized by Richard Dawkins?

    • Thanks: Arthur MacBride
    • Replies: @PhysicistDave
  35. Leo Den says:
    @R2b

    The (((usual suspects))) are behind Covid. They hate mankind with a passion. Their god Satan drives them.

    http://biblicisminstitute.wordpress.com/2020/03/07/the-dirty-secrets-behind-covid-19/

    • Replies: @R2b
  36. Much of this article is philosophical nonsense, even if somewhat interesting.

    Molecular biology techniques have advanced past growing DNA in bacterial plasmids, excising the gene sequence of interest, then inserting it into a virus or animal. Combining UNC’s Baric’s No See Um approach to remove obvious signs of restriction enzyme sites, then selecting for function in serial human cell culture allows the desired functional outcome. It is somewhat more “natural” than old bioweapons research, which left telltale signs of gene manipulation. Nothing nefarious without intent; in the case of viruses initially manipulated (as with the addition of the furin cleavage site –WITH telltale human Arginine codons!– to the clade of bat coronaviruses naturally lacking them) the virus grows better in culture (higher titers mean more experiments can be performed, quicker). While culturing in human target cells, there is selection for Spike protein mutations that may originally have been better suited to bats or pangolins or mice. And even if such selection works to develop a faster-growing (more infectious) human-specific virus, there are no immune components to the system (although further passaging through animals may approximate that). As to origins of SARS-CoV2, we will likely never know what really happened unless bat coronavirus virologists come clean. However these soul-less creatures are desperately protecting their careers, their consciences somehow not overly affected by the 3.75 million, and counting, Covid-19 deaths globally.

    It is more useful to focus on possible problems ahead. Geert vandem Bossche and other authors have noted the folly of vaccinating huge numbers of people during a pandemic. When viruses are present in huge numbers, statistically it is much more likely that new variants will appear under the selection pressure of the vaccine-evoked antibodies. Although Western vaccines are solely aimed at the virus Spike protein which binds to human ACE2, and massive amounts of protective antibodies are made only to this part of the virus, the question is whether selection of Covid-19 variants with enough infectivity and virulence will be selected. If given before or after an epidemic, with low virus amounts circulating, such selection is very unlikely to occur. Worst case is a variant which binds to the spike protein and is PROTECTED from the immune system; antibody enhancement occurs with dengue, and with some animal coronaviruses, but is unlikely. Fortunately coronaviruses, at least with natural immunity, are targeted by memory T cells and cellular immunity more so than by the more specific antibodies. The cellular immunity is much longer-lived though much less specific than the antibodies, and should provide enough immunity to protect from death, even if symptomatic. Common cold coronaviruses, which provide some cross protective (cellular) immunity to Covid-19, probably account for most of the 20-50% natural immunity in populations unexposed to SARS-Cov2.

  37. The three Jews in the Hoover Institute video are clearly against the White science of Darwin but instead, are peddling the Judeo-Christian non-science of the Bible, i.e. their own mythologies. Hopefully, the outer space aliens will soon arrive (at least, that’s what Obama and Harry “the Mormon” Reid are peddling of late) to put an end to malarkey!

  38. Iva says:
    @onebornfree

    hank you for this post. From some sources I hear that there wasn’t an “isolation” , but some scientists I know say “YES it was”. From this video I learned that what they “CALL ISOLATION” is Not an isolation!!!!!

  39. onebornfree says: • Website

    “From this video I learned that what they “CALL ISOLATION” is Not an isolation!!!!!”

    Yes, exactly. The definition of the word “isolation” was just conveniently changed so that “isolation” of a “virus”can then be claimed to have occurred.

    Here’s a good summary of the fake isolation of the CV-19 “virus”, from Jon Rappoport:

    “What? You call that isolation? You didn’t isolate anything. You just stirred the soup in the dish. Explain yourself. And the gene you say you just tweaked? What gene? Let’s go back over that again. You just fiddled with DATA about a gene in a so-called virus. Makes no sense. Let’s review that move. Let’s break it down………we’re supposed to have faith in what these researchers have faith in.If this amounts to science, Kool-Aid is the nectar of the gods.”
    https://blog.nomorefakenews.com/2021/05/31/wuhan-lab-bioweapon-gain-of-function-but-the-virus-doesnt-exist/

    Furthermore, here’s a question that has never been answered: if the virus was really real , why would they need to justify its existence with a fake test for it? Surely they’d have a genuine test, and not use the fake PCR test which is in no way a diagnostic tool?

    Regards, onebornfree

    • Agree: St-Germain
    • Replies: @thordaddy
  40. @skrik

    Fair enough, and thanks for a few enlightening morsels – but I´m still unconvinced 😉

    – The ill-advised conflation of ID and Rona was probably meant to plumb the possibilities of natural occurrence … which, from what the humble geologist knows about the behavior of genes, is the default position anyways; IOW the burden of proof for manipulation is a bit heavier than what I have seen to date.

    • Replies: @Peripatetic Itch
  41. “I don’t really need Stephen C. Meyer to explain to me why the odds of a randomly-mutated DNA sequence coding for a useful protein that could play a role in a beneficial mutation are so prohibitively low that the whole Darwinian paradigm collapses.”

    It doesn’t matter that the odds of naturally created proteins are prohibitively low when you consider the huge number of occurences in nature over billions of years for such mutations to occur. The Darwinian paradigm is a fact. The idea of a designer is merely a fairy tale. All 30,000 of them.

  42. @PhysicistDave

    I think the author Kevin Barrett made an unfortunate choice to use the term ‘intelligent design (ID),’ instead of something more accurate/neutral like ‘deliberate design’ because of the former term is loaded. It carries a strong paleo-religious fundamentalist /Luddite perjorative connotation with many scientifically educated/oriented persons of a certain age.

    I submit that poor choice of a key term in this article’s context, permits the easier manipulation and conflation of the meaning of the ‘ID’ term in comments like the one above, leading to misunderstanding in casual readers’ minds, and the misimpression that people who entertain the lab design/bioengineered virus hypothesis as viable, are somehow ignorant and backward, when in fact that is not the case, and I believe, not in line with the overall thrust of Barrett’s piece.

    • Replies: @PhysicistDave
  43. Don’t know the answer. I do find random evolution to be a little far fetch. As to everything being designed by God or Aliens, well it obviously became a flawed project.

  44. skrik says:
    @GomezAdddams

    Headline of your citation:

    “18:19, 10-Jun-2021
    Scientists explain why COVID-19 lab leak theory doesn’t hold water
    CGTN”

    This item is little more than hand-waving, aka propaganda. China learns from ZUSA, the main pushers of *lying* propaganda. To effectively counter propaganda one needs to cite *facts*, here is one article:

    https://www.documentcloud.org/documents/6981198-Analysis-of-Six-Patients-With-Unknown-Viruses.html

    “Analysis of Six Patients With Unknown Viruses”

    .. from may, 2013. Those interested may read it, but the ‘upshot’ of it is that six miners contracted some [ghastly] unknown disease, 3 of whom died after all suffered for months.

    There are 3 things that could be said about this article:

    1. The mineshaft where the miners worked before becoming ill was in exactly the same area as where Dr Shi collected RaTG13, and in the same time-frame,

    2. The suffering miners may well have had their immune systems ‘compromised,’ thus providing a mutagenic environment and

    3. Being ‘on the spot,’ Dr Shi may well have collected samples from, say, the miners’ lungs.

    Note that this is in no way a criticism of Dr Shi, who was carrying out her ‘normal’ job, partly financed by EcoHealth. Nor is this any insinuation that Dr Shi’s BS4 lab was at any time ‘leaky.’ What this article *does* do, is to provide us with a possible pathway to a zoonotic event, plus samples. I discussed what may have resulted above in my #25.

    But me no buts? There is still a small ‘problem,’ actually two:

    1. Bats live there but pangolins are a) an illegal import into China and b) the sample of MP789 came from the Guangdong border, where CoV-sick pangolins were detected, protected but all died.

    2. We still do not know by whom, when or where the PRRA was ‘inserted.’ rgds

  45. Anon[282] • Disclaimer says:

    “What are the odds that all of these random occurrences would perfectly mimic
    what we would expect from a US biological attack on China’s economy? ”
    Exactly!
    And what are the odds that the CIA, being desperate to unseat President
    Trump, would be handed a ‘flu virus’ on a silver platter to parlay it into
    their most cherished outcome?

  46. Sean says:

    “In fact, we don’t know where most of the viruses that infect us have come from,” said Geoghegan. “This is why we need to sample more viruses in nature and expand our knowledge of the diversity of viruses that exist.”

    That was the rationale for the GOF experiments in Wuhan, but the Board Chair of the Foundation for Vaccine Research in Washington DC (one Simon Wain-Hobson) said he didn’t see that as a proper cost benefit analysis .

    With scientists’ efforts, more novel coronaviruses are coming to light, Hayman added.

    As opposed to being in a dark horseshoe bats’ cave in remote areas of the Yunnan–Guizhou Plateau, which is hundreds of miles from Wuhan.

    Some of the farmed wild animals, including ferret-badgers and rabbits, “could provide an intermediate host for the virus to jump to humans,” said Geoghegan. And their complex commodity chains make it possible that “the farms could well be in places where there was a greater diversity of bat viruses than in Wuhan, where the pandemic appeared to have started,” said Hayman.

    Excuse me? The only Horseshoe bats in Wuhan were at the Wuhan Institute of Virology, which filed patents for “bat rearing cages” and “artificial breeding” systems in early 2019.

    The genome sequence of the SARS-CoV-2 showed it to be 96 percent similar to a coronavirus found in horseshoe bats

    Which is exactly the type of bats that the Wuhan Virology Institute were working on. In 2017, US diplomats in Beijing attended a presentation and were alarmed to be proudly told by the Chinese that Wuhan Institute of Virology had found a remote cave hundreds of miles with away horseshoe bats harboring a 3 new species coronavirus , all with with exceptional capabilities for infecting humans and thus for becoming a potential pandemic pathogen. The US Embassy sent a series of teams to check on whether the Wuhan facility was operating appropriate to the level of containment proper to such dangerous experimentation. The finding of the US biosafety experts were that the The Wuhan Institute of Virology was insecure.

    https://www.nature.com/articles/d41586-017-07766-9
    nature news article
    NEWS
    01 December 2017
    Bat cave solves mystery of deadly SARS virus — and suggests new outbreak could occur
    Chinese scientists find all the genetic building blocks of SARS in a single population of horseshoe bats. […] To clinch the case, a team led by Shi Zheng-Li and Cui Jie of the Wuhan Institute of Virology in China sampled thousands of horseshoe bats in locations across the country3. “The most challenging work is to locate the caves, which usually are in remote areas,” says Cui. After finding a particular cave in Yunnan, southwestern China, in which the strains of coronavirus looked similar to human versions4,5, the researchers spent five years monitoring the bats that lived there, collecting fresh guano and taking anal swabs1.

    If there are myriad coronaviruses harbored by bats, and you sample enough, then eventually you are going to come across something very transmissible if it gets into humans. So take the bats and their Satan Bug home to your Wuhan Institute? Nooooo, leave the coronaviruses in the bats and the bats in their cave.

    • Replies: @skrik
  47. Dumbo says:
    @anon

    First of all, I never said I am a Creationist.

    Secondly, your reply is stupid, because that’s not what I said at all.

    I never said that “If man arose by chance, life would have no purpose or meaning.”

    In fact, I never said anything about the “purpose of life”!

    I said that EVOLUTION itself, according to Darwin and later proponents, has NO PURPOSE (or direction) meaning that it is RANDOM and BLIND (“The blind watchmaker”, as Richard Dawkins called it), caused by “random mutations” and later “natural selection” “of the most fit”.

    Therefore, viruses can’t “find a niche” and “evolve” as if according to a plan.

    The fact that I contest some aspects of the Darwinian theory of evolution doesn’t necessarily make me a “creationist”, just someone who thinks that the theory doesn’t explain a lot of things.

    Learn to read!

  48. @Mulga Mumblebrain

    Why do people get so easily distracted into the good cop / bad cop dichotomy?

    Why don’t they consider that several global powers conspired on this? The relative uniformity of response and lack of pushback that there even IS a ‘pandemic’ should have been major clues that many Governments were not taken by surprise.

    Now, I read that China and the EU are speaking of having digital currencies quite soon rather than later and noticed that the US media significantly ramped-up coverage of cryptos in the last year. The supply chain breakdowns look quite intentional to me as do the supposed corporate cyber-attacks.

    Gee, it’s as if we are in a globalist operation to establish major control of the world and shift it to a digital one.

    Then this legislator decides to alert people to a Rockefeller Foundation paper published in 2010 that discusses a scenario very like this one. Those are plenty of easy dots to connect for me.

    • Thanks: Agent76
  49. dimples says:
    @skrik

    “b) no ‘external agency, supernatural or not’ can manipulate matter, summarised as no external intelligence, no mechanism = no ID [plus no ‘creator’ as a ‘bonus’].”

    This is just the dogma you believe. You have not seen the supernatural at work so you are just sadly ignorant. The supernatural is like any other science. You must look for what there is to see, as with any other scientific line of enquiry. The data does not come to you, as with any other line of scientific enquiry.

    There is no question that matter and energy can be created from nothing. You only need look for the evidence. Try it like any other field of scientific enquiry. They don’t call it the ‘Hidden Power’ for nothing.

    • Replies: @skrik
  50. Wuflu is a planned, US deep-state invention…how do I know? Because they told us so in advance!

  51. Covid-19 does not exist, it has never been isolated, therefore it does not exist, it is an illusion, a concept created by the demented minds of the WEF, the Rockefeller and Gates Foundation, UN Agenda 2030 and the zionist owned central banks of the world including the FED, which is how they were able to roll out this illusion world wide at virtually the same time.

    This covid-19 illusion has been used to destroy the economies of the world and by using hype, hysteria, and fear to drive people into taking the genocide injections of mRNA which alters the DNA and destroys the immune system and is a genocide agenda. In addition this is not only a genocide agenda but a satanic one world government agenda that will make this world hell on earth.

    This is not a conspiracy theory, this is a blatant , in our faces , destruction of the world as we know it.

    • Agree: JasonT
    • Replies: @The Real World
  52. skrik says:
    @Sean

    So take the bats and their Satan Bug home to your Wuhan Institute? Nooooo, leave the coronaviruses in the bats and the bats in their cave

    One rationale for CoV-research is a) to find out what’s ‘out there’ in order b) to do some future-anticipation/prediction but most importantly c) to develop ‘life-saving’ measures, like anti-viral treatments, say. GoF was added into the mix, possibly only via EcoHealth sponsorship ‘requirements.’ We have had an actual case of a [Z-commanded] attack on a person wherein the attack was correctly identified and an antidote was demanded, provided and successfully administered. Sooo, is SARS-CoV-2 a bioweapon, and if so, who has an antidote or effective treatment? [Good Q; recall here that vaccine EUAs are only granted when there is no *accepted* treatment available. Note also that these mRNA vaccines have become *absolute* best seller/earners.]

    A posit: IF Dr Shi was developing [dangerous] chimeras THEN did she simultaneously develop any counter-measures? Suggested A: Possibly, but because China is under [economic, ideologic and sheer cussedness] attack, Dr Shi&Co may well prefer to keep any effective treatment to themselves. We had a commenter who suggested exactly that = the Chinese did not control their COVID-19 by lockdowns but by effective medication, but [on specific request] that poster (@Thim) provided no further detail. But consider an anti-posit, that IF CoV-2 was primarily an attack on the Chinese, THEN the attackers would hardly convict themselves by disclosing that yes, they have an antidote/treatment [only reserved for specific VIPS, of course.] rgds

    • Replies: @Sean
  53. Agent76 says:

    May 31, 2021 Veteran Speaks on Health and Environmental Effect of 5G

    Mar 31, 2021 Industry Capture of 5G EMF Health Reports by ICNIRP & WHO EMF Project by Dr. Lennart Hardell

    This talk is an excerpt from Tallinn June 3, 2019.

    January 17, 2021 5G Wireless Technology Is the “Stupidest Idea in the History of the World”

    According to Washington State University Biochemistry, Medical Science Professor Martin L. Pall.

    https://www.globalresearch.ca/5g-stupidest-idea-history-world/5675638

  54. skrik says:
    @dimples

    You have not seen the supernatural at work … There is no question that matter and energy can be created from nothing

    Haw. Kindly provide some credible proof [reputable, checkable citations, say – IMHO impossible], otherwise it’s *you* who’s sadly ignorant.

  55. @IvyMike

    From what I have read, the virus needed to pass through 3 or 4 other specific species (adapt and infect) before it could infect humans naturally. I may be wrong.

  56. Wuflu and its supposed consequences are all a US deep-state planned invention…how do I know? Because they told us so years in advance!

    This real journalist references same report in Comment 49 above, but did so years ago:

  57. @PhysicistDave

    Well, you and your fellow scientists should be able to find one or more good science writers to cogently refute Meyer. Your side is at a huge disadvantage when a brilliant, lucid science writer like Meyer is making a strong prima facie case, and the most prominent refutations are obviously fallacious.

    Speaking of which, your “refutation” citing the probability of the improbable, the existence of many planets over vast amounts of time, and so on, is vague and unconvincing, as you would learn if you actually read Meyer’s book, which quantifies the probabilities involved with great specificity, and finds them such that the odds of random mutations producing the necessary levels of information to drive certain necessary steps in macroevolution are unimaginably too low. What we need is an equally specific refutation written up by a good science writer.

    • Replies: @Notsofast
    , @PhysicistDave
  58. Ross23 says:

    Lots of coincidences:

    1. The virus was discovered down the road from China’s main bio lab

    2. The virus came into being just when faster broadband allowed millions to do their job from home not 15 years ago

    3. About 3 separate vaccines were developed and released at the same time

    4. Released about 4 working days after the US election of course

    5. The virus occurred in China not some crappy little county with worse hygiene just when a major battle for hegemony was starting with US

    6. The US army was there just a couple of months before

    7. We’re told death rates are sky high but overall deaths are showing normal patterns

    8. The major pusher for the vaccine is someone who used to push for depopulation

    9. A new peer review finding states it’s the spike protein that does the damage but of course not the same one the vaccine is getting your body to make

    10. Things that are supposed to help with COVID are being suppressed and are suddenly dangerous to take despite being available for decades, the latest is NAC

    11. Vitamin d is no good they say until the vaccines are released then suddenly they say it is and give it out

    There’s so many more I could name but don’t have the time.

    • Thanks: Sean
  59. I’m posting a similar message twice in the hope that it saves some lives.
    My wife got Covid and had fever, chills, sore throat, ear ache and I convinced her to take Ivermectin 12 mg that first day, I took one as well and we took a tablet for the next few days.
    The day after, i.e. 3rd day I too felt unwell and had a slight fever (99F to 100F).
    My symptoms did not worsen but four days later, my sense of smell vanished. It came back slowly in about a week.
    As for my wife, she too got well in 5 days but had diarrhea for another 20 days and is now perfectly well.
    I started on Ivermectin (12mg) before I had any symptoms while my wife had the first dose on the first day her symptoms were visible.
    Now I’m hearing a lot of talk about even those who have had covid should take the jab. Why I should do so is never clearly explained even though people who have had both the jabs are getting Covid 19.

    • Thanks: Alfred
    • Replies: @The Real World
  60. Sean says:
    @skrik

    Er, China has hundreds of nuclear weapons, has conventional superiority in its own backyard to the extent that a land war is a non starter and it has a dependent North Korean state to act as proxy. It would not, could not just sit there after being attacked with a bioweapon to wait for the next manufactured plague being better targeted at them. China is no innocent victim of an attack and they know it. Or innocent victim of its wildlife, for they and America were at least culpably negligent and reckless despite all the warnings. It worked out well for them because they got rid of Trump, now the Western elite can get a full share of what they have been longing for; everyone is greedy for access to China’s enormous and growing market. Which is more reliable the a member of the British establishment writing in the WSJ or Vice Magazine? British science and economics journalist, also businessman, Matt Ridely, writing in the WSJ.

    https://www.nature.com/news/engineered-bat-virus-stirs-debate-over-risky-research-%201.18787

    Then in 2016, Ralph Baric and colleagues at the University of North Carolina at Chapel Hill showed that the same bat virus could infect live mice that had been engineered to express the human gene for the ACE2 receptor. The virus was “poised for human emergence,” as the title of Dr. Baric’s paper put it.[…]

    Significantly, the same analysis shows that the most recent common ancestor of the human virus and the RaTG13 virus lived at least 40 years ago. So it is unlikely that the cave in Yunnan (a thousand miles from Wuhan) is where the first infection happened or that the culprit bat was taken from that cave to Wuhan to be eaten or experimented on.[…]

    Rather, it is probable that somewhere much closer to Wuhan, there is another colony of bats carrying the same kind of virus. Unless other evidence emerges, it thus looks like a horrible coincidence that China’s Institute of Virology, a high-security laboratory where human cells were being experimentally infected with bat viruses, happens to be in Wuhan, the origin of today’s pandemic.

    First of all, Baric did not just take a virus straight outta Yunnan and check it out, he did gain of function modifications along with researchers including Xing-Yi Ge and Zhengli-Li Shi of th Wuhan Virology Institute. “In order to study it in a lab, scientists have created a hybrid version of a virus that could be the world’s next pandemic — a SARS 2.0,” Vice Magazine

    https://www.nature.com/news/engineered-bat-virus-stirs-debate-over-risky-research-%201.18787
    Lab-made coronavirus related to SARS can infect human cells.

    Declan Butler
    12 November 2015
    In an article published in Nature Medicine1 on 9 November, scientists investigated a virus called SHC014, which is found in horseshoe bats in China. The researchers created a chimaeric virus, made up of a surface protein of SHC014 and the backbone of a SARS virus that had been adapted to grow in mice and to mimic human disease. […] But other virologists question whether the information gleaned from the experiment justifies the potential risk. Simon Wain-Hobson, a virologist at the Pasteur Institute in Paris, points out that the researchers have created a novel virus that “grows remarkably well” in human cells. “If the virus escaped, nobody could predict the trajectory.

    The elite, including the Deep State and the corporate–foreign policy nexus, have turned into lickers of Chinese boots. Government employees, academics and political ‘pragmatists’ are the willing minions who turned a blind eye to the Wuhan manufacture of Fentanyl, so them ignoring-indeed funding –the manufacture of a world-wide pandemic in that city shouldn’t surprise. These bien pensants think international cooperation (such as the Pentagon paying for projects in which Wuhan scientists learned in America how to make hybrid viruses and then got that risky research outsourced to them) and integrating China into the world economy is a win-win. The digital yuan is going to be enforced by China on everyone doing business there.

  61. @Sean

    To evaluate the improbableness of an occurrence, one must begin by asking “What is the reference class?” The Wuhan Institute of Virology is a leading world center for research on coronaviruses and perhaps the premier one for research into bat coronaviruses. It was being funded to research potential pandemic bat coronaviruses and as part of that work it was creating new and especially virulent human coronaviruses. If the pandemic was caused by the deliberate use of a bioweapon then Wuhan was chosen because per a ‘lab accident’, it provided an explanation for such a high degree of human–human transmissibility.

    The reasons for thinking that the virus did not “escape” from WIV are various. In the first place, the first instances of Cov-19 did not appear in Wuhan. There are numerous instances of Italians who claim to have had it before 2020 and there is an ex-mayor of a city in NY state who claims to have had it before 2020. (Melham believes he could potentially be an early, undetected case of the coronavirus.
    (https://www.northjersey.com/story/news/essex/belleville/2020/04/30/belleville-nj-mayor-tests-positive-coronavirus-antibodies/3057925001/ )
    (Typically, he seems to have “vanished down the memory hole, when I searched for him on the internet!” Fortunately I had this reference in my computer.)

    The second reason is the extraordinarily guilty-type behaviour of the US CDC, for example banning autopsies and tests on people suffering from Covid-like diseases in the US before the disease “officially” arrived in the US and also their making the proceedings of the CDC “Top Secret” and putting a complete blanket of security over their discussions, in a way that, I should think, is pretty well unprecedented for a civilian organization. (Seattle lab only uncovered extent of Washington coronavirus outbreak after breaking government rules
    https://www.independent.co.uk/news/world/americas/coronavirus-lab-testing-red-tape-cdc-fda-seattle-washington-a9395891.html )

    The third is the finding by Japanese virologists, that there were, at the time their work was published (on Taiwan TV); five mutations (of increasing age) of Cov19 in the USA and only the third one was present in Wuhan and that the Japanese early cases had caught it in Hawaii. (Taiwanese TV: https://m.weibo.cn/status/4477008216030027#&video
    )

    The fourth is the existence of the so-called “Vaping Disease” which had almost exactly the same symptoms as Cov-19, but has completely disappeared since Cov-19 “arrived” in the US.

    The fifth is the silence of the US authorities on the subject of why the bio-war lab in Fort Detrick was closed down in late July, as dangerous to the public.
    (Mid August 2019, Fort Detrick bio-weapons lab was shutdown for safety violations, including thousands of cases of leaks of research pathogens, and thefts of vials of unknown origins.
    (https://www.military.com/daily-news/2019/08/11/maryland-senator-pens-letter-army-over-fort-detrick-lab-shutdown.html)
    December 2019, Fort Detrick germ warfare lab partially reopens after a federal inspection found two failures in containing unnamed germs or toxins.
    (https://www.salon.com/2019/12/07/the-army-quietly-re-opens-its-infamous-germ-warfare-lab_partner/)

    The sixth is the report of the US Intelligence of “an epidemic of a nasty fever” raging in Wuhan, a month or so before the Chinese authorities were aware of it. (i24 (Israeli TV in French) says the US spies in China told Trump about the outbreak in Wuhan in November.
    https://www.i24news.tv/fr/actu/international/1587061098-le-renseignement-americain-a-mis-en-garde-israel-contre-le-coronavirus-mi-novembre-channel-12?fbclid=IwAR2i_LO2GZFpEO16CSeIMoRIMKjILt-J5NX60lT9g6COdr-0Au-9zFyYUx4

    https://www.timesofisrael.com/us-alerted-israel-nato-to-disease-outbreak-in-china-in-november-report// )

    To cap it all, is the “certainty” of the MSM that it was China’s fault from the earliest days of the outbreak, long before any real finding could have been made.

    • Thanks: Peripatetic Itch
    • Replies: @Anonymous
    , @Sean
  62. Unfortunately, there are millions of people (not bad ones) for whom the sum of capital
    letters in someone’s emails may mean “the Perfect Storm is coming”, and repeatedly.
    As well as millions of those for whom the sum of the names of four Sep.11. planes adding
    up exactly to 911 means nothing, and sincerely.
    Not sure if these groups overlap, but it doesn’t matter – they are not much different from
    each other anyway, belonging to the same “Unwilling helpers” group below.
    There are other large (smarter) groups, the number of which will depend on how precise
    one would like to differentiate them.
    I’ll just go with the big picture, how it looks to me:
    “Conspiracy Practitioners”, “Willing helpers (of Conspiracy Practitioners)”,
    “Unwilling helpers”, and “Conspiracy Theorists”.

  63. Rurik says:

    there are, it seems to me, three basic motivations for the ID view

    One is that ID was ingrained into people since childhood, and a belief in a God-like father figure who’s out there to protect His children from all the scary dangers out there in the real world, is obviously a welcome belief for certain types of people.

    Two is that many people don’t want this life to be the end of it all. They’re very fond of being alive, and understandably so, that they’d like to believe that it goes on forever. It’s obviously very comforting to believe so, for obvious reasons.

    Three is the idea that humans are nothing more than somewhat hairless great apes that can talk and walk and drive cars and so forth, being related to those ugly grunting simian creatures, is very unpalatable for many, if not most humans. Whose vanity is very much assuaged by the idea that humans are something different in kind altogether from the rest of the animal kingdom. A God-like being, in fact. Created in the image of God Himself, if you ask most of them.

    Lol

    But alas it’s not true, and we are all, down to the last DNA molecule; apes. If rather extraordinary apes.

    But rather than bad news, this is actually good news. Because being so, we aren’t supposed to measure up to a God, which we all fail at miserably, but rather being animals, we’re really rather remarkable animals, all things considered.

    One reason I bother writing this, (since it will no-doubt be dismissed by most people for the reasons above ; ) , is that believing as so many do; that humans are removed from the animal kingdom by divine ordination, makes them believe that they’re free to treat animals like something different in kind, from humans. Rather than fellow beings who’re only different by degree.

    This arrogance is the justification for treating animals so cruelly.

    There no reason why humans shouldn’t eat other animals, that is natural. But to keep them in cages their entire lives, or subject them to merciless experiments and other horrors, is unconscionable, once you realize they’re just as capable of suffering as we are. Even if they can’t articulate it in the same way.

    photo of a gorilla’s fingers with one missing the pigment, underscores our shared ancestry

    As we treat the animal kingdom, (or each other, for that matter) surely it reveals to what degree humans deserve to consider themselves divine or worthy of a God.

  64. The only thing that following this irrelevant rabbit hole down accomplishes is fulfilling its goal as a massive distraction as the population continues to be injected with an experimental and fatal bioweapon injection.

    The real story is how a change in law in 2014 allowed the massive infrastructure of the U.S. government to bombard us with pro-vaccine propaganda – in effect, killing us with our own tax dollars.

    And right now it’s the only story we need to be discussing.
    https://www.brighteon.com/067ed3a8-3856-4016-b55b-cc5484a66905

    Non-video version: https://theveryfirstbible.medium.com/bioweapon-injections-military-grade-propaganda-and-the-marcionites-a-timeline-6ae452a01efa

  65. Anonymous[793] • Disclaimer says:
    @foolisholdman

    A great summary.

    To add one more piece in the puzzle: The unbelievable “coincidence” of Covid-19 arising at the precise place, and at the precise time, such that it would have spread like an uncontrollable wildfire across China.

    Wuhan is a crucial transport node, where high-speed trains from all over China pass on their way to all points of the compass. Chinese New Year sees the greatest human mass-movements on Earth, all across China.

    If the Pandemic outbreak had taken place in Wuhan, but NOT during their New Year, that would be believable as coincidence. Or, if an outbreak had started during the New Year, but ANYWHERE ELSE other than Wuhan, perhaps another (slightly less plausible) coincidence.

    But to have it be BOTH at a very central transport node, AND at the very moment that truly enormous numbers of people were transiting through there?

    THAT is overwhelmingly likely to be DELIBERATE. In fact, the probability begins to approach, IMHO, 100%.

    • Replies: @Ron Unz
  66. @Rev. Spooner

    Why I should do so is never clearly explained even though people who have had both the jabs are getting Covid 19.

    Don’t do it….
    https://www.wfla.com/news/no-vaccine-needed-for-those-whove-had-covid-19-cleveland-clinic-study-says/

  67. Ron Unz says:
    @Anonymous

    Wuhan is a crucial transport node, where high-speed trains from all over China pass on their way to all points of the compass. Chinese New Year sees the greatest human mass-movements on Earth, all across China…THAT is overwhelmingly likely to be DELIBERATE. In fact, the probability begins to approach, IMHO, 100%.

    Sure, I generally agree. But if you read the various articles I’ve published since April 2020, you’d discover there are numerous additional pieces of evidence, some even more persuasive. I’ll take the liberty of extracting a few of the crucial paragraphs and add a link below:

    But with the horrific consequences of our own later governmental inaction being obvious, elements within our intelligence agencies have sought to demonstrate that they were not the ones asleep at the switch. Earlier this month, an ABC News story cited four separate government sources to reveal that as far back as late November, a special medical intelligence unit within our Defense Intelligence Agency had produced a report warning that an out-of-control disease epidemic was occurring in the Wuhan area of China, and widely distributed that document throughout the top ranks of our government, warning that steps should be taken to protect US forces based in Asia. After the story aired, a Pentagon spokesman officially denied the existence of that November report, while various other top level government and intelligence officials refused to comment. But a few days later, Israeli television mentioned that in November American intelligence had indeed shared such a report on the Wuhan disease outbreak with its NATO and Israeli allies, thus seeming to independently confirm the complete accuracy of the original ABC News story and its several government sources.

    It therefore appears that elements of the Defense Intelligence Agency were aware of the deadly viral outbreak in Wuhan more than a month before any officials in the Chinese government itself. Unless our intelligence agencies have pioneered the technology of precognition, I think this may have happened for the same reason that arsonists have the earliest knowledge of future fires.

    According to these multiply-sourced mainstream media accounts, by “the second week of November” our Defense Intelligence Agency was already preparing a secret report warning of a “cataclysmic” disease outbreak taking place in Wuhan.  Yet at that point, probably no more than a couple of dozen individuals had been infected in that city of 11 million, with few of those yet having any serious symptoms.  The implications are rather obvious.  Furthermore:

    As the coronavirus gradually began to spread beyond China’s own borders, another development occurred that greatly multiplied my suspicions. Most of these early cases had occurred exactly where one might expect, among the East Asian countries bordering China. But by late February Iran had become the second epicenter of the global outbreak. Even more surprisingly, its political elites had been especially hard-hit, with a full 10% of the entire Iranian parliament soon infected and at least a dozen of its officials and politicians dying of the disease, including some who were quite senior. Indeed, Neocon activists on Twitter began gleefully noting that their hatred Iranian enemies were now dropping like flies.

    Let us consider the implications of these facts. Across the entire world the only political elites that have yet suffered any significant human losses have been those of Iran, and they died at a very early stage, before significant outbreaks had even occurred almost anywhere else in the world outside China. Thus, we have America assassinating Iran’s top military commander on Jan. 2nd and then just a few weeks later large portions of the Iranian ruling elites became infected by a mysterious and deadly new virus, with many of them soon dying as a consequence. Could any rational individual possibly regard this as a mere coincidence?

    https://www.unz.com/runz/american-pravda-george-orwells-virus-lab-leak/#the-case-for-an-american-biowarfare-attack

  68. @Desert Fox

    Covid-19 does not exist,

    It’s pretty amazing that 1.5 years into this there are still people who make that claim.

    How are they so unable to compute that there IS a unique virus AND globalist forces also manipulated testing, withheld medical treatments, fudged death numbers (even intentionally killed some) and on and on? They did it for the the reasons you mention next in your comment.

    I got slammed hard in Feb 2020 and it was NOT the friggin flu. Incapacitated for two weeks and with lingering symptoms for months. Thankfully, they are gone since Sept 2020 but I was beginning to believe I would always have them.

    They haven’t succeeded in locking down your brain, have they?

    • Replies: @Desert Fox
  69. Sean says:
    @foolisholdman

    In the first place, the first instances of Cov-19 did not appear in Wuhan.

    And also point three and four’

    The secoThe fifth is the silence of the US authorities on the subject of why the bio-war lab in Fort Detrick was closed down in late July, as dangerous to the public.
    (Mid August 2019, Fort Detrick bio-weapons lab was shutdown for safety violations, including thousands of cases of leaks of research pathogens, and thefts of vials of unknown origins.nd reason is the extraordinarily guilty-type behaviour of the US CDC,

    A Wuhan branch of the Chinese Centre for Disease Control and Prevention is 700 yards away from the wet market where most of the earliest cases cluster. But not the very earliest ones.

    The fifth is the silence of the US authorities on the subject of why the bio-war lab in Fort Detrick was closed down in late July, as dangerous to the public.
    (Mid August 2019, Fort Detrick bio-weapons lab was shutdown for safety violations, including thousands of cases of leaks of research pathogens, and thefts of vials of unknown origins.

    This is about horseshoe bat coronaviruses that had been subjected to gain of function and other virology techniques. Only China has the bats with the relevant viruses, and the only place in China (probably the world) where bat coronaviruses with the ability for sustained transmission between human were being studied and quite possibly amped up was the Wuhan Virology Institute, which was eight miles from the wet market that was hundreds of yards from an office of the Chinese Centre for Disease Control and Prevention.

    Simon Wain-Hobson, the world’s most celebrated virologist had caused something of an uproar among US scientific funding and US health authorities when he publicly pointed out in 2015 that a US/ Wuhan Chinese team had created created a novel coronavirus chimera that “grows remarkably well” in human cells. And “If the virus escaped, nobody could predict the trajectory“. That takes care of assertions that incredibly stupid US conspirators thought they could predict the outcome based on the (presumably natural origin) 20o2 SARS outbreak.

  70. d dan says:

    The author is not very wise to create a controversial and tenuous link from a very controversial and unsettled issue (the origin of Covid-19) with yet another controversial and emotional issue (intelligence design). If the intention is to persuade or to convince, does he target only the small conjunctive groups of believers (i.e. believers who agree with both issues, or “preach to the choir”), or does he think he can miraculously cut through all the controversies to bring at least one group to his side by linking their share belief in the other issue?

    There are people who don’t even believe that the virus exists (see the comments thread). The path to convince is audacious and tedious. It is better to focus than to digress or to distract.

    • Agree: PhysicistDave
  71. BG. says:

    A virus what’s pops up approximately or exactly 100 years after the Spanish flu subsided must me released by humans. What are the odds????

  72. Alfred says:
    @PhysicistDave

    If the IDers had a mathematical argument

    I assume IDer’s are people who believe in Intelligent Design. Please correct me if I am mistaken.

    • Agree: PhysicistDave
  73. Can anyone explain the reason(s) or the rational for the pentagon to developing a warning systems and a recognition system for the presence of a bio-weapon in a conflict? Also to create the related antibodies in order to protect its personnel in the field? Please only for reasons other than the evil intentions!
    Development of SARS COVID-1 in early Y2000 was the first experiment which the virus was spread as far as the Shanghai region. The latest development was the COVID-2 (aka-19) which was the “mission accomplished” experiment in order to attack the known enemies who happened to be either a competitive economically like China or politically being a thorn in the ass like Iran. Period.

  74. @The Real World

    I challenge you to show any source that says covid-19 has been isolated, and also they are saying that the flu disappeared , yes , it was relabeled covid-19, do some research.

  75. @Desert Fox

    I don’t care if it’s been isolated (have yet to see anyone front a valid link regarding that non-isolated claim – strange). Many diseases exist for decades before they are isolated or diagnosed or adequate tests are created. That should be obvious.

    Yes, the seasonal flu was re-branded in 2020/2021. That’s why it “disappeared” (it didn’t). Covid is not the seasonal flu.

    Open your mind….it doesn’t cost anything.

    • Replies: @JasonT
    , @Dumb4asterisks
  76. @Sean

    I’m sorry. For once I agreed with much of that which you elucidated, including Wain-Hobson’s observations. I was referring to the reports of laboratory problems by lying (it goes without saying) US diplothugs. Probably part of the Pompeo et al plan to lay blame at China’s door for the plain US bio-warfare attack.

    • Replies: @Sean
  77. @Sean

    Back to your old ways, I see. There is NO evidence that only the WIV has the relevant bat coronaviruses. The history of Pentagon biological prospecting, worldwide, for organisms to be studied as potential bio-weapons goes back to the 50s, at least. The WIV was co-operating with US labs like that at the University of North Carolina and the Pentagon/USAID (CIA)/State Department operation, the EcoHealth Alliance. This bio-warfare attack has been long planned, with threats that ‘China will get a cold’ being made by loose-lipped racists. Why don’t you racists demand that US bio-warfare labs be opened up to ‘weapons inspection type’ investigation?

    • Replies: @Sean
  78. Agent76 says:

    Oct 3, 2009 H1N1 Influenza update

    In an interview conducted on September 15, 2009, Dr. Anthony Fauci, the director of the National Institute of Allergy and Infectious Diseases, provided an update of 2009 H1N1 influenza.

    May 2, 2020 FAUCI NAMED AS DNA TERMINATOR FROM VACCINE – 1994

    DR. FAUCI was a key player in a “virus induced pandemic” 10 years ago during the AIDS crisis and is still playing Dr. Mengele (Angel of Death) today with new buddy, Bill Gates.

  79. Notsofast says:
    @Kevin Barrett

    thank you mr. barrett for your courage in confronting established “expert opinion” and laying the gauntlet on their doorstep. let’s see if mr. and mrs. smarty pants phd’s pick up the gauntlet ( or you too ron unz with your fancy gold boxes ) and rise to the challenge. i’d pay $100 to watch the ppv.

  80. JasonT says:
    @The Real World

    Look and listen to the video posted in onebornfree’s comment #9 above for a discussion of what “isolated” means to a virologist in comparison to what the word means to everyone else.

    Also, “seasonal flu” is a moniker given to a set of symptoms that occur in people twice a year. Even if you believe in viruses, the “seasonal flu” is not just the influenza virus and its variants, but also coronaviruses, rhinoviruses, other viruses and their variants. There is a great variability in the symptoms and severity of the condition called the “seasonal flu” from season to season. The past symptoms experienced in the 2020-2021 flu season are not unusual and have occurred in prior seasons.

    And yes, in North America the number of patients labelled with having the ‘flu’ as opposed to COVID-19 dropped almost to zero in 2020-2021. This plainly tells me that the ‘seasonal flu’ has been rebranded as “COVID-19”.

    We are living in illusion generated by nefarious people.

    “Open your mind….it doesn’t cost anything.”

    • Agree: Agent76
    • Replies: @The Real World
  81. Gwen says:
    @PhysicistDave

    I’ve been reading here for about three years, rarely commenting. I used to look forward to your comments, but not anymore. You seem to have become a horse’s backside. Gold box or not.

    • Agree: R.G. Camara
    • Thanks: PhysicistDave
    • Replies: @R.G. Camara
  82. thordaddy says:
    @onebornfree

    The “virus” is real…

    A real “virtual virus.”

    Infinitely more powerful than either a naturally-occurring novel virus or a sloppily-released man-made bioweapon.

  83. @nokangaroos

    the burden of proof for manipulation is a bit heavier than what I have seen to date.

    Burden of proof arguments are too often self-serving. They usually just argue that I claim DIBS on one side of the debate just because I hold it. Therefore you on the other side have to come up with something extraordinary to make me change my mind.

    DIBS is a child’s game too often imported into matters of science with great effectiveness but little validity.

    • Agree: JasonT
    • Replies: @nokangaroos
  84. @Kevin Barrett

    Kev wrote to me:.

    Your side is at a huge disadvantage when a brilliant, lucid science writer like Meyer is making a strong prima facie case, and the most prominent refutations are obviously fallacious.

    You seem to think that we care that we are at some “disadvantage.”

    Don’t you get it: we don’t care.

    I gave you a reference that you can follow up on that shows that these guys are clowns.

    I also explained briefly that their calculation is jut completely wrong: organisms do not choose a protein at random from the space of all possible proteins. Rather, evolution modifies existing proteins in various ways. That fact is crucial: the IDers are doing the wrong calculation.

    That fact makes complete nonsense of the IDers’ argument.

    By the way, the reference that Steve Meyer misquoted the title of is the study from the 1966 Wistar Institute symposium: the correct title is Mathematical Challenges to the Neo-​Darwinian Interpretation of Evolution. I checked that out in our local university library decades ago: it is just laughable. Scientists do not take it seriously because it ignores the most basic known facts of actual biology.

    And you think Meyer is a “brilliant” science writer? Yeah, and I am a better dancer than Fred Astaire, and a better trumpet player than Satchmo!

    Meyer speaks coherently and knows how to sound authoritative and sincere. He’d make a great used-car salesman.

    But “brilliant”?

    Kev, science is about actual knowledge, not whether you could do a good job of playing a scientist in a movie.

    No doubt Meyer would make a better “scientific authority” in a motion picture than I or other real scientists would. But Meyer does not know what he is talking about, and I gave you a reference above that you can check out to confirm this.

    If of course you wanted to go to the trouble. If you cared about the truth rather than about which “side” is at a “huge disadvantage.”

    We scientists are not playing the IDers’ game, Kev. They bore us. We just don’t care.

    • Agree: nokangaroos
    • Replies: @Adrian
  85. Lots of bad arguments in this article, but let’s go straight to the top. The Easter Island heads analogy is just plain stupid. The face on Mars is a much better one.
    https://duckduckgo.com/?q=face+on+mars&t=hc&va=u&ia=web

  86. Did COVID-19 jump from animals to humans due to random mutations? Or was a bat coronavirus deliberately tweaked to infect humans via gain-of-function research? The topic has been hotly debated since January 2020.

    How do we know that there is an actual “pandemic” at all? Because politicians and media outlets claim that there is? Since when have they told the truth about anything? Where are the piles of bodies?

    If there is no “pandemic,” then it is a waste of time to argue about where the “pandemic” came from.

    • Agree: JasonT
    • Replies: @Sean
  87. @The Real World

    Yes, the seasonal flu was re-branded in 2020/2021. That’s why it “disappeared” (it didn’t). Covid is not the seasonal flu.

    It seems to me that you are contradicting yourself. You say that the seasonal flu did not “disappear” [“That is why it “disappeared” (it didn’t)”]. But then you say that the seasonal flu, now rebranded [“Covid, is not the seasonal flu.”] So, the past season’s flu is simultaneously the seasonal flu, but also not the seasonal flu, simply because it is called “Covid”. I think your mistake is to assume that it cannot simultaneously be both the seasonal flu and Covid, the latter simply being the name for the last season’s flu. Your statement that “Covid is not the seasonal flu” is therefore mistaken. It is indeed the seasonal flu, and giving each season’s flu a new name every year does not change it into “not being the seasonal flu”.
    So, why do people not want Covid to be called or associated with the seasonal flu? Because that might detract from how serious they regard the latest flu to be, and the measures they want to be taken. For some the last flu is regarded as so serious compared to previous ones, that it requires a brand new name, not only to distinguish it in seriousness from the other flues without lock downs, masks, jabs and the rest, but to create the illusion that it is a totally different disease, defying comparison and therefore also defying comparison in treatment. Otherwise people might wonder: we had flues before, without the panic and severe measures. Then comparisons will have to be drawn between the severity of previous flues and the latest (Covid) flu, to justify the glaring differences in treatment. But if people can be conned into believing that the latest flu is not just different in severity but in fact a different disease as such, then they can be misled into believing that any call for comparison to justify difference in treatment is inappropriate because it is an entirely different disease – which explains your and others’ insistence that “Covid is not the seasonal flu”, even if contradicted by the plain fact, as you also admit, that the seasonal flu did not “disappear” simply by calling it “Covid”; the seasonal flu will be with us for as long as flues and colds exist by whatever newfangled names, as will be our propensity to distort – for a good cause, of course.

    • Replies: @The Real World
    , @AnoNZ
  88. @JasonT

    1 -How many influenzas have you had in your life that produced symptoms that lasted for more than 6 months?

    2 – How many influenzas have you had that, in addition to ALOT of other intense symptoms, produced a raised rash that roved all around your body in giant patches?

    Then it disappeared in matter of a few hours such that there was nothing for the dermatologist to see at appointment time. But, upon hearing my description of the prior days and inspecting my skin, the Doc felt confident I had not had an allergic reaction.

    Sound like “the flu” to you? Do tell…..

    • Replies: @JasonT
  89. An invisible molecule CO2 is blamed for Global Warming, this is used politically as an existential threat to humanity.

    An invisible virus Covid-19, undetectable with your senses, is blamed for normal flu season. The imaginary new virus, unproven by scientific method, is used politically to shutter the entire economy.

    Government funding insures scientific experts come forward proving the government case. All those who dissent are immediately silenced, threatened, disappears, marginalized, lose their jobs.

    The next bogeyman is said to be an alien invasion. You will not be able to discern it’s reality, like CO2 and Covid you will have to trust the experts on the television.

  90. @Dumb4asterisks

    I didn’t contradict; you didn’t follow my meaning. Perhaps it could have been stated more clearly but, simply……Covid is a disease and the flu is one also. The flu disease in 20/21 was fake identified as Covid, on purpose, to boost case numbers for illicit reasons.

    Just a thought…instead of contorting things to fit some outcome that you prefer…why don’t you research the symptoms and experiences of people who had real cases of it? There is much to learn from doing that and would save time from insisting things about something you haven’t experienced..

  91. @Gwen

    FisicDavey likes to post random attacks on Catholics in his comments. He’s just a typical bigot.

    • Thanks: PhysicistDave
    • Replies: @nokangaroos
  92. Kapyong says:

    WTF ?
    Cdesign proponentsists on Unz ?

  93. bayviking says:

    The video is a most interesting presentation of “Intelligent Design”, which includes a bit about just how complicated and poorly understood cell biochemistry is. A recent SA article covered slimes, single celled clustered organisms, which exhibit intelligence by always growing towards food sources in a remarkably efficient manner, not random at all. So this implies sensory reception of some sort and intercellular communication.

    The entire discussion fails to consider that cell inherent intelligence based on memory and communication can completely change their simplistic mathematical probabilities. Things that do not work are rarely if ever repeated as far as the most fundamental elements of cell biochemistry are concerned. By the time mammals emerged fundamental shapes of birds, fish, apes, dolphins, corals etc were already established. They were not really starting over.

    Nevertheless, it is clear Darwin, like Newton, and all of us live in a far more complicated universe than either of those pioneers could ever imagine.

    It is ironic that Corona hurt the US far worse than China and an evil US action cannot be ruled out. But the simplest documented explanation goes back to 2012 when 3 of 6 miners died after shoveling bat guana. Wuhun lab sent an investigator, collected samples which are an exact or close match to Covid19. This was revealed from translated papers from Wuhun reprinted here. It should not surprise anyone that the samples were played with, that is what these labs do. Whether an act of war or an accident the public should be demanding they be shut down. Otherwise something like this will happen again.

    • Replies: @skrik
  94. @Desert Fox

    Check this video out ( minute ~18:00 =>) for Richard Fleming’s PhD, MD., view and explanation of what is generally understood and accepted in the virology field, as the normal isolation/identification process for a new virus, using present day genetic manipulation and analysis techniques:

    https://thehighwire.com/videos/is-covid-19-a-bio-weapon/ (starts at 18:00 min)

  95. Seraphim says:

    Australia is a piece of ‘circumstantial evidence’ in the puzzle of the ‘origins’ of COVID-19. There are no cases of infections transmitted by people coming directly from Wuhan. The strain that spread throughout Australia was traced back to people coming from England or disembarked from cruises whose closest point of contact with China was Hong-Kong and Japan!

  96. Adrian says:
    @PhysicistDave

    Physicist Dave said about Steve Meyer: .”He’d make a great used-car salesman.”. If he was joined by the two characters below ihe would have the most brilliant sales team ever.

    From the internet:

    In 1999 Time Magazine listed Kurt Gödel as one of the most influential mathematicians of the 20th century.   As a colleague of Albert Einstein, Gödel and Einstein were able to converse on equal terms on Einstein’s theory of Relativity – Gödel once producing a novel solution to Einstein’s field equations that caused Einstein to express concerns about his own theory.

Gödel also once expressed a concern about the mathematical underpinnings of evolution.  Writing to his colleague Hao Wang he noted “The formation within geological time of a human body by the laws of physics (or any other laws of similar nature), starting from a random distribution of elementary particles and the field, is as unlikely as the separation by chance of the atmosphere into its components.”    
    For Kurt Gödel – whose key insight demolished the cumulative efforts of a century of mathematical formalism embodied in Russell and Whiteheads’ three volume “Principia Mathematica” – the laws of physics were too simple in nature to account for biological complexity in available time.

    On the back of a basic concern by the twentieth century’s most eminent logician it seems reasonable that 150 years of research would have uncovered a demonstrable mathematical model – one that unambiguously charts how order arises de novo through chance processes, and described with the normative degree of precision and abstraction applicable in all fields of mathematics and physics research.   

    Given the ubiquitousness of the theory of evolution such a model would be as justly famous as the theory of Relativity – with its key equations quoted regularly in the press and routinely appearing in the appendix of virtually every biological textbook.

    Seen this mathematics recently?   Or are we confusing observations of common descent with unquantified common assent? “

    and:

    On January 12th, 1982, Sir Fred Hoyle delivered the Omni Lecture at the Royal Institution, London, entitled “Evolution from Space,” which was later reprinted in a book by the same title … In it he discussed the overwhelming improbability of getting the enzymes needed for even the simplest form of life to function by chance.
    … The difference between an intelligent ordering, whether of words, fruit boxes, amino acids, or the Rubik cube, and merely random shufflings can be fantastically large, even as large as a number that would fill the whole volume of Shakespeare’s plays with its zeros.

    So if one proceeds directly and straightforwardly in this matter, without being deflected by a fear of incurring the wrath of scientific opinion, one arrives at the conclusion that biomaterials with their amazing measure or order must be the outcome of intelligent design [my emphasis]. No other possibility I have been able to think of in pondering this issue over quite a long time seems to me to have anything like as high a possibility of being true. (27-28)

    • Replies: @PhysicistDave
  97. @ghost of q.mensch

    ghost of q.mensch wrote to me:

    I think the author Kevin Barrett made an unfortunate choice to use the term ‘intelligent design (ID),’ instead of something more accurate/neutral like ‘deliberate design’ because of the former term is loaded. It carries a strong paleo-religious fundamentalist /Luddite perjorative connotation with many scientifically educated/oriented persons of a certain age.

    Well, Kevin’s problem is that he chose to conflate two completely separate issues.

    First, where did Covid 19 originate?

    As I have mentioned, my wife has a PhD in biology and has worked in the biomedical field. From very early on, based on our own experiences working in labs, we both found the lab-leak theory very plausible. Accidents happen in labs — all the time.

    I myself once zapped myself with 3 kiloVolts of electricity (and lived to talk about it — what they tell you about not being grounded is true). I was cutting corners, violating site safety rules. STEM people do that all the time: we’re pretty smart and, if we are careful enough, we can do it safely.

    Usually.

    If we are careful enough…

    After Nicholas Wade’s article came out online… well, we both think it probably leaked from the Wuhan Institute lab. It may well have been engineered in the lab: David Baltimore, former president of my alma mater, Caltech, and a Nobel laureate in the field, seems to think so (see Wade’s article).

    But Kevin insisted on conflating the lab-leak issue with the issue of whether there is proof that evolution has not been simply a matter of random mutations and natural selection. The claim that there must be some sort of further design in evolution is normally referred to as “Intelligent Design.” Whether it is called “Intelligent Design” or “deliberate design” does not really make much difference.

    And Kevin insisted on deriding all of us scientists who reject a crack-pot theory based on an erroneous calculation that scientists have known to be wrong for more than a half century:

    Their opponents [i.e., those of us who reject the mistaken calculation], seemingly reluctant to debate on mathematical grounds, fling ad hominems and non sequiturs, obfuscations and diversions, mischaracterizations and stale bromides…

    Kevin does not seem to understand that science is not some sort of eternal high-school debate in which scientists should or physically can spend their lives refuting every single crack-pot Tom, Dick, and Harry who proposed some idiotic theory based on an obviously incorrect mathematical calculation.

    I’ve spent too many hours of my own life trying to do that, but there are just too many idiotic Toms, Dicks, and Harrys out there eager to bombard us scientists with theories that are obviously false, and no matter how carefully we explain their errors to them, it has no impact. There is quite literally not enough hours in human lifetimes to engage all of these kooks.

    It is physically impossible for us to do it.

    I have given Kev a link to a paper that does explain the error those guys in the video that he links to are making.

    I have briefly mentioned the key point: it is not true that evolution proceeds by choosing at random within the space of all possible proteins. Evolution proceeds by tweaking existing systems — whether proteins, developmental processes, or whatever.

    The three clowns in the video Kev linked to do not get this.

    And I suspect Kev does not want to get it either.

    • Replies: @Ron Unz
  98. @St-Germain

    St-Germain wrote to me:

    So, “too many decades” of independent thought to suit the modern grant-driven campus clique and their sacred repository of superior knowledge that may not be questioned?

    No, the clowns in the video Kev linked to made a mistake. They did the wrong calculation based on a misunderstanding of chemistry, biology, and math.

    It is not intolerance or arrogance to refuse to take seriously an obvious mistake.

    You seem to think that the fact that the three clowns in the video Kev links to are not actually scientists somehow makes their crack-pot claims more credible.

    That is truly crazy.

    It is of course possible, though unusual, for people who are non-scientists to point out some scientific error.

    But in the case of these three clowns, their error is straightforward and easy to understand: it is not true that in the process of evolution proteins are somehow created de novo out of a random selection of all possible proteins.

    They did the wrong calculation.

    SG also wrote:

    Your five-paragraph argument from authority obviously hasn’t debunked or discredited anything. But it has ducked the core issue raised by Kevin Barrett and convincingly laid out in mathematics by Stephen Meyer and other ID writers.

    Any normal person with a university education should be able to understand that they did the wrong calculation.

    I provided a link to a paper which explains their error (see especially Section 3).

    You can bluster all you want, but they made a mistake.

    SG also wrote:

    Please share a few of your consensus relevations on what lesser mortals ought to believe about neo-Darwinism.

    You really are unwilling to stop silly rhetorical posturing and instead learn enough to understand that these clowns made a mistake, aren’t you?

  99. Sean says:
    @Mulga Mumblebrain

    There is is abundant evidence that only the Wuhan Virology Institute held the coronaviruses most closely resembling the one that caused the Covid-19 pandemic. Even if they did not modify them, they sought them out and brought them to 8 miles of where the global pandemic started, Sherlock. Again:-

    To clinch the case, a team led by Shi Zheng-Li and Cui Jie of the Wuhan Institute of Virology in China sampled thousands of horseshoe bats in locations across the country3. “The most challenging work is to locate the caves, which usually are in remote areas,” says Cui. After finding a particular cave in Yunnan, southwestern China, in which the strains of coronavirus looked similar to human versions4,5, the researchers spent five years monitoring the bats that lived there,

    In 2065 Xing-Yi Ge and Zhengli-Li Shi of the Wuhan Virology Institute were taught by Baric to do gain of function modifications : “The researchers created a chimaeric virus, made up of a surface protein of SHC014 and the backbone of a SARS virus”. “In order to study it in a lab, scientists have created a hybrid version of a virus that could be the world’s next pandemic — a SARS 2.0,” Vice Magazine (2016). The Wuhan Institute of Virology, which filed patents for “bat rearing cages” and “artificial breeding” systems in early 2019. The lust for glory here is of ambitious scientists in China and America.

    The history of Pentagon biological prospecting, worldwide, for organisms to be studied as potential bio-weapons goes back to the 50s, at least.

    Now look, the CIA did experiments with LSD, but don’t blame them for your bad ‘trip’. While it may be true that the Wuhan Virology Institute was in a roundabout way funded by the Pentagon it was not they who restarted gain of function research funding. Fauci ordered that in 2017 and outsourced it to China; heaven only knows what his real motivation was, but it got rid of Trump so the entire Deep State was happy with the outcome. Again, the National Institutes of Health that lifted a 3-year moratorium on funding gain-of-function (GOF) research on potential pandemic viruses such as avian flu, SARS, and MERS, opening the door for certain types of research to resume. ‘“Rather than use the avian flu moratorium to seek advice, listen and foster debate, many influenza scientists engaged in an academic exercise of self-justification,” Wain-Hobson, then chair of the Foundation for Vaccine Research in Washington, DC, explained in a remarkably-prescient 2013 Nature editorial. “It is too easy for scientists in a field to dismiss criticism and ideas from outside.”

  100. @R.G. Camara

    I see you do not understand – we papists do not have the slightest problem with this 😀

    So Augustinus was right again – what else is new?
    Teilhard de Chardin is about as far as a scientist can go in good conscience –
    and he has the creds from both sides if you´re interested; I´ve always found
    Dawkins a bit obnoxious … frothing-at-the-mouth atheism and missionary fervor
    are not necessary, though his arguments are unassailable.

  101. Checheno says:
    @Sean

    Hey Sean, sorry for the inconvenience and totally deviating from the topic but in another comment you mentioned that Hitler’s policy in Eastern Europe was not necessarily that of extermination, you even mentioned that Gotz Aly has a book on plans to Germanize families in Eastern Europe. I was wondering what exactly that book is since the author has several and certainly his names do not inspire much confidence in me.
    By the way, if it’s not a bother I would like to ask you if you know more objective books about Hitler and the Third Reich, I am focused on reading about that subject right now, and I have already read the best known: Irving, Toland, Stolfi, Fest, the memoirs from Kubizek, Beevor, Gerwarth.
    You’re a one of the most read and intelligent guys I have seen on these dissident websites, I would appreciate if you could recommend some books to this Nazi zoomer.

    • Replies: @Sean
  102. AnoNZ says:
    @Dumb4asterisks

    So, why do people not want Covid to be called or associated with the seasonal flu?

    It isn’t about what people want. You’re conflating a corona virus with an influenza virus.

    SARS-COV-2 and ‘FLU’ are not the same thing, not even close. COVID-19 is the name given to the disease caused by infection of SARS-COV-2 virus.

    SARS-COV-2 is not an influenza virus, it is a corona virus. Influenza is a different type of virus entirely compared to SARS-COV-2, each being structurally unique compared to one another, each infecting human cells differently – e.g. binding to different cell receptors. SARS-COV-2 binds to the ACE-2 receptor whereas Influenza viruses bind to the glycolipid receptor.

    • Replies: @Sean
    , @Dumb4asterisks
  103. @Peripatetic Itch

    If then it was an attack (and, mind you, I wouldn´t be surprised),
    “plausible deniability” would be its most important characteristic;
    given the severity of the consequences methinks a wee phlegm is in order 😉

  104. @Adrian

    Adrain,

    Hoyle and Gödel knew very little about biology, but then they did not devote their careers to proving this ignorance to the public.

    Steve Meyer also knows very, very little about biology, but he is devoting himself to proving this fact in public, again and again and again.

    Instead of citing authorities who are not actually authorities on this matter, why don’t you actually read Ard Louis’ paper, especially Section 3, that I have cited again and again?

    And then you will know the truth: in speaking about biology, Gödel , Hoyle, and Steve Meyer did not know what they were talking about. The difference is that Gödel and Hoyle did not pretend to know much about biology, but Steve Meyer does pretend.

    No need for dueling pseudo-authorities: just read Louis’ paper.

  105. Sean says:
    @Checheno

    Architects of Annihilation: Auschwitz and the Logic of Destruction by Götz Aly and Susanne Heim. (Economic technocrats seeing rural overpopulation as the main problem).

    Hitler: Only the World Was Enough by Brendan Simms (recommended).
    The Psychopathic God: Adolf Hitler by Robert G. L. Waite (Hitler’s inner character)
    Blood and Soil: Walther Darre and Hitler’s Green Party (surprisingly large rural component to Hitler’s support, also Tooze ‘s book)
    Europe: The Struggle for Supremacy by Brendan Simms (Historical background of other powers trying to control the manpower and resources of the German nation).
    The Tragedy of Great Power Politics by John Mearsheimer (Theory of offensive realism)
    .

  106. Ron Unz says:
    @PhysicistDave

    After Nicholas Wade’s article came out online… well, we both think it probably leaked from the Wuhan Institute lab. It may well have been engineered in the lab: David Baltimore, former president of my alma mater, Caltech, and a Nobel laureate in the field, seems to think so (see Wade’s article).

    You and your wife obviously have strong scientific backgrounds, and I’m very glad you’ve taken the time to rebut some of the Intelligent Design nonsense unfortunately promoted in this article. However, I think you should take a much more careful look at the Covid origins issue.

    I’ve been friendly with Nicholas Wade for about a decade, and his excellent article completely punctured the massive propaganda-bubble of a natural virus that had been inflated by the incompetent MSM since early 2020. However, it’s important that you not fall into casually accepting a different propaganda-bubble, namely that the outbreak was the result of a Wuhan lab-leak, a hypothesis that is supported by essentially ZERO significant evidence.

    Instead, as I’ve been pointing out for more than a year now, there’s actually strong perhaps even overwhelming evidence that the global epidemic was the (unintended) result of an American biowarfare attack against China (and Iran). I strongly suggest that you take the the time to carefully consider the two most recent articles in my series:

    https://www.unz.com/runz/american-pravda-the-truth-and-the-whole-truth-on-the-origins-of-covid-19/

    https://www.unz.com/runz/american-pravda-george-orwells-virus-lab-leak/

    Given the total reversal of the establishment MSM narrative over the last few weeks, others are starting to reassess their perspectives. For example, a couple of eminent mainstream academic scholars who had been quite skeptical of my analysis over the last year have now begun to shift strongly in my direction. I suspect that someone of your scientific background might find my arguments quite compelling.

    • Replies: @Sean
    , @PhysicistDave
  107. @PhysicistDave

    To Hoyle´s credit he was a first-rate scientist before he began seeing bacteria.

  108. Sean says:
    @AnoNZ

    Yes, influenza is different to Covid -19. As mentioned by Professor Wain-Hobson in his talk (linked above) ferret badgers are the most frequently used experimental animals for influenza studies.

    https://www.taiwannews.com.tw/en/news/4132037 Meanwhile, an Australian geneticist who publishes scientific papers under the name Zhang Daoyu told Taiwan News in an email that the ferret-badger ACE2 receptor cannot bind to the S1 subunit of the spike protein. He added that animals cannot be infected with the disease in-vivo, and adaptations in them give a very different receptor-binding motif (RBM) than what is currently seen in SARS-CoV-2, the virus that causes COVID-19.

    Another of Daszak’s claims is that rabbits were sold at the wet market and the animals “turn out to be quite susceptible to SARS-CoV-2.” However, Zhang said that since the currently observed RBM of SARS-CoV-2 does not efficiently use ferret-badger ACE2 and is not optimal for binding to rabbit ACE2, this rules out the possibility the virus may have “naturally” adapted to these two species

    The venal running dog opportunist Peter Daszak was appointed to the official World Health Organization comission on enquiry along with six other ‘failed to disclose potential conflict of interest’ signatories to the letter published in the Lancet (ran by yet another licker of Chinese boots) denouncing the lab leak possibility as a conspiracy theory is now espousing China’s risible contention that frozen ferrets being sold at Wuhan’s Huanan Seafood Wholesale Market are the cause of the respiratory infection pandemic. The Wuhan Virology Institute had ferret-badger, rabbits and of course bats. But who would think abducting bats and probing their anuses would annoy them so much they would try to exterminate humanity with global pandemic? OK, a 1979 movie, for one. Here is the Wuhan Virology Institute’s 2019 patent application for cages to imprison and breed the bats sourced from Google.

    Daszak’s EcoHealth Alliance gave $3.4 million in grants from the National Institutes of Health to the Wuhan Institute of Virology do work with bat coronaviruses between 2014 and 2019. Moreover Daszak, thanked Dr. Anthony Fauci for publicly discounting that idea that the Covid -19 pathogen
    (bat) coronavirus leaked from a lab. In view of his getting the funding ban for GOF and them supplying the funding to Daszak who gave it to the Wuhan Institute of Virology, Fauci is another one who didn’t declare an apparent conflict of interest. Perhaps he forgot about it. EcoHealth Alliance also got funded by the Pentagon, with a whopping $39 million. Think about it the fact that CCP Chinese are happy with Daszak investigating the Wuhan Institute of Virology as a source of the pandemic, even though Daszak’s ‘non-profit’ is funded by the Pentagon.

    • Replies: @ghost of q.mensch
  109. Adrian says:
    @PhysicistDave

    I am a complete outsider in this debate. I was just struck by your vehemence and the disdain you showed for your opponents.

    Stephen Meyer’s conversation partners were dismissed as “clowns” – not real scientists.

    Where a “real scientist” is mentioned (Fred Hoyle) he is dismissed as too ignorant about biology. But apparently Ard Louis, who is not a biologist either, makes the grade because he is arguing on the right side of the question. He is a Christian and states that he is against ID partly on theological grounds. With Stephen Meyer exactly the opposite is the case.

    You tell me that Ard’s argument is undeniable. From the other side I am being told that Douglas Axe’s arguments are undeniable – welll at any case he is a molecular biologist.

    For what it is worth here is a list of seven Nobel Prize winning scientists who either more or less endorsed intelligent design or attacked Darwinian evolution. None of them was a biologist – but you might find it a bit difficult to dismiss them as “clowns”:

    https://uncommondescent.com/intelligent-design/seven-nobel-laureates-in-science-who-either-supported-intelligent-design-or-attacked-darwinian-evolution/

  110. skrik says:
    @bayviking

    Wuhun lab sent an investigator, collected samples which are an exact or close match to Covid19

    Errr, that’s not my understanding; could you please provide an exact quote/source? Thanks in advance. rgds

    • Replies: @bayviking
  111. JasonT says:
    @The Real World

    Sounds like the effects of microwave radiation.

    • Replies: @The Real World
  112. @AnoNZ

    Thank you and to Sean for setting me right that flu and Covid are indeed different diseases. I obviously assumed incorrect facts to support my suspicion. My apology.

  113. skrik says:
    @Adrian

    I am a complete outsider in this debate … Where a “real scientist” is mentioned (Fred Hoyle) he is dismissed as too ignorant about biology

    Not just “ignorant about biology,” Hoyle was a ‘rogue scientist’ in that “in particular his rejection of the “Big Bang” theory” going on to “in 1948 began to argue for the universe as being in a “steady state””

    Now, of course, there’s nothing wrong with people having ‘alternate theories’ [a very big task of scientists is to *disprove* putative theories – Feynman] but IF Hoyle got the big bang wrong [where there’s overwhelming evidence], THEN why could he be cited on ID – where there’s *zero* evidence? Besides, we don’t do the ‘argument from authority’ (argumentum ad verecundiam) fallacy. rgds

  114. Sean says:
    @Ron Unz

    I don’t think you are suggesting an American “biowarfare attack against China (and Iran)”, but a very small group of Neocons mounting a bioweapon attack on China and Iran, which would be extremely risky for them (they’re not dubbed the ChickenHawks for nothing). No General or Director is going to obey an out of the chain of command and thus treasonous illegal order from a ludicrous windbag character like Bolton, who is a mere appointee. Trump is commander in chief of the armed forces and only he welds the authority of the people’s will to give an order of the enormity of bioweapon attack on China and have it executed. If it happened, it had to have been Trump, tribune of the people who said China was raping the US with the cooperation of its elites and got elected into the White House on that basis.

    Now that our elite media and political establishment seem ready to recognize the artificial nature of the virus ”’

    That was in a lab does not mean it was created there. The Wuhan Institute of Virology have never denied that they were sampling viruses from the wild and bringing them to Wuhan; that was the business of their institute– to researching natural bat coronaviruses. They called her Bat lady because for years she been engaged in a a quest for the bat coronaviruses that might be capable of causing a pandemic i. humans. The virus could have been found in a cave in Yunnan and brought to the Wuhan Institute for Virology on the anal swab of a bat in a remote region. If you sample enough bat coronaviruses it would be almost expected for one to be particularly dangerous . In other words: it maybe was a completely natural virus in a lab, from where it was accidently released by infecting staff members. Or maybe there was an escape of a completely natural virus and then some kind of natural mixing ; that’s a real possibility.

    • Agree: Johnny Rico
    • Replies: @Mulga Mumblebrain
  115. @Sean

    Meanwhile, an Australian geneticist who publishes scientific papers under the name Zhang Daoyu told Taiwan News in an email that the ferret-badger ACE2 receptor cannot bind to the S1 subunit of the spike protein. He added that animals cannot be infected with the disease in-vivo,

    I don’t know what to make of that quoted assertion by the Australian geneticist. It does not line up with all the media reports last year of large covid outbreaks on mink fur farms across Europe and in parts of North America, and mass cullings of the farmed animals, in which the disease was seen as being mild, not lethal to the minks, but cullings were supposedly done anyway as control measure to stop the risk of the mink farms being covid spreader/variant mutation hotspots to nearby human populations.

    https://news.google.com/search?q=covid%20minks%20denmark%20holland&hl=en-US&gl=US&ceid=US%3Aen

    If what the AU geneticist says (ie., weasel/stoat/ferret/mink family can’t be infected by covid virus) is in fact true, then were all the reported mink farm CV outbreaks and cullings actually part of some massive fake news information operation /PR campaign to hype the CV fear in Europe and N. A. in order to herd panicked populations into complying with the lockdowns?

    That sounds a bit too dastardly Bond-supervillain-ish even for me to entertain seriously. I would have to remain skeptical about it at this point.

    • Replies: @Sean
  116. Trying to redeem myself (mainly with atheists) from my blunder above, please excuse this re post of a prior comment of mine, but it seems pertinent to the topic. In my view, if it was nor for religion, the creation/design debate would probably now be on a par with the flat/round earth debate, where religion in the meantime “discovered” that the pillars supporting the earthly disc was just metaphor. Not wrong, just not to be taken literally. Creation? Not wrong, just not to be taken literally.

    Have you read Dawkin’s The blind Watchmaker where he shows how as complex an organ as the eye could develop without the help of any “watchmaker” and of which the intermediate stages of development can still be found today in living organisms?

    Have you seen the stupid design of the laryngeal artery of the giraffe by “intelligent” design?

    and its pathetic typical attempted refutation, (with comments turned off in U-tube. Wonder why. Ha, ha.) [Comments still turned off at this posting]

    Dawkins: The artery’s design is stupid.
    Critic in video above:
    1. No, it’s not because we are just stupid/ignorant of its cleverness. So, when we see something clever, it proves ID, but if we see something stupid, it does not disprove ID, it just proves our stupidity. (Hey, how come we are not also stupid when we think we see “clever” design? Seems ID holds an unbeatable hand.)
    2. Even if it is stupid, it still is “design”. (Hey, what happened to the ‘intelligent’ part? O, I see, ‘intelligent’ does not matter, as long as we have a design requiring a designer. Thus another designer god is saved to fashion in our preferred image. OK, I now admit that it does require intelligence to design such a scheme that fools most of the people most of the time. Just as long as such intelligence is from our own true designer God and not somebody else’s fake designer god.)

    • Replies: @Intelligent Dasein
  117. skrik says:

    Or maybe there was an escape of a completely natural virus

    Wishful thinking. There’re villains’ fingerPRRAnts all over it. It is a despicable product and was a deliberate release. rgds

  118. Tim too says:

    the issue for me in the random vs intelligent design vs deliberate design vs not random and not deliberate, vs whatever, is that there is no tractable theoretical point for experimentation.

    There is nothing in the ‘debate’ that has any significance in practical experimentation. No testable points.

    Thus the ‘we don’t care’ position. To be significant, there has to be some point that is testable.

    It isn’t a debate. It is pointless arguing. It can’t be resolved, and so, ‘don’t care’.

  119. bjondo says:

    Evolution, not so much selection, is real:
    tri wing plane, bi wing, DC-7, 707, 747,
    Fs:15, 16, 17, 18, 19, 22, 35 (sometimes a mistake is made).
    NASA Shuttle, a branch-off like gorilla. Some sort of kin?

    All these evolved from the covered wagon.
    From what the covered wagon?
    Uncovered of course.
    ————————————————————————-

    Evolutionary butt pains: gravity, sleep. thought/mind.
    ————————————————————————-

    Nothing wins a discussion like arrogance and titles/degrees/empty scholarship.
    I top off at 3 days – 4th grade, nothing published.

    My almost 4th grade opinion: Fauxci Balony Corony was/is a bioweapon(US, NATO) intentionally released. Too much censorship, aggression, deceptions, lies. The vaxx is a weapon, part 2.
    ——————————————————————————————-
    Saw the name “Dawkins” somewhere.
    Now he is an evolutionary regression.

  120. @Adrian

    – There is a very distinct pathology we call “Old Nobelists´Syndrome”, characterized by the entitlement to pontificate on whatever topic under the sun; it predates modern “pundit” culture as already the great Svante Arrhenius was not immune
    (“Venus is covered in tropical swamp, with civilization only on the poles”).
    Shockley kept his dignity but got cancelled before it was cool …

    there are too many examples but the major point, as skrik ably laid out,
    is “false authority”.
    The only Nobelist to consult on this would be Manfred Eigen.

  121. Sean says:
    @ghost of q.mensch

    The truth is stoatally different to what you think ‘

    How adaptaion works can be weasily understood

    https://www.molecularecologist.com/2015/02/24/bigger-on-the-inside/
    Maybe birds that are sufficiently efficient fliers can seek out seeds to fit any beak size. If we add that new dimension to my original crude sketch, the valley between small beaks and big beaks turns out to be not an unbridgeable chasm, but more of a cirque, with a path from A to B that never loses altitude, provided flight efficiency (“another trait”) can adapt at the same time.

    {I}f you consider that the dimensions of the adaptive landscape are limited only by the dimensions in which living things vary, this logic suggests that there might actually be many paths between phenotypes that look like well-separated peaks when viewed in only two or three dimensions. You might also start to feel a sense of the overwhelming space of possibilities that natural selection sorts through. This is no longer a landscape that Charles Darwin can stroll across on a thoughtful afternoon; it needs more science fictional imagery, like the starship Enterprise warping space to cross light-years in a day

    Ferret badgers are in their own genus. They can be infected with Covid -19, but not in vivo. That means in normal conditions, not labs commercial farms. The idea of frozen food or a frozen packaging origin is absurd (no instance of a respiratory virus ever being caught that way), but Duszak and the Chinese state appear to be seriously suggesting it through him and their other hirelings in the WHO. No one has tried to quash the lab origin except Duszak and he did it in a rather covert way with other Sino-toadies. Fauci and the Pentagon both funded EcoHealth Alliance. The Pentagon gave a whopping $39 million to the “non profit”‘ of Duszak, and the Chinese are happy to have him on the WHO enquiry into the origin of covid. Alliance indeed; all Trump’s enemies China, the first generation American government employees Lewis wrote about in the Fifth Risk, the MSM, military and corporate-medical nexus getting people hooked on opioids, which are available cheap from Wuhan. Look at Bat Lady and with Duszak. The man is obese. According to a book by eminent genetics researcher Andreas Wagner, that I have linked to a review of, intelligence is analogous to natural selection, but creativity is more like genetic drift. Wagner does not think much of the way things are done in China, as another reviewer writes

    The human parallel with natural selection is laissez faire competition, which is efficient but equally intolerant of trial and error. Far more productive are systems that don’t penalize failure but encourage play, experimentation, dreaming, and diverse points of view. In this vein, American schools fare poorly, but Asian schools are worse.

    We don’t need China or Chinese–or other–immigrants for anything. Eventually CCP China will not be put back in their box , they’ll be destroyed. So unnecessary, but so inevitable.

  122. Sean says:
    @Mulga Mumblebrain

    Pompeo is someone you dislike but have an extremely high opinion of apparently. I think he is a fat fool, whose sins were of omission . In his 2014 talk, Wain-Hobson actually mentioned ferret-badgers, which is what the Chinese and their pet scientists are trying to say was the origin of the Covid -19 outbreak, because they were sold in the Wuhan market. Frozen or otherwise, who wants to eat ferrets? The same people who the US medical and military establishment outsourced the dangerous coronavirus research to, that’s who. Wuhan had the level of biosecurity of a dentist’s office for much of that time, and even when they got a proper facility it was not properly staffed. So of course the US ceased its ban on gain of function research and in a wonderful example of what international co-operation can achieve, American taxpayer funded institutions plus the Pentagon used Wuhan Institute of Virology for the word’s most dangerous research. Those responsible ought to be hanged and left from sunup to sundown.

  123. @Sean

    Thanks for sharing the neat ferret video. As long as we are on the subject of mustelids, you might want to check out the assortment of honey badger vids.

    They are tough nasty little bastards that can escape from anywhere, and thus serve as the unofficial mascot for Covid.

    https://www.youtube.com/results?search_query=honey+badger

    PS: Still not clear you meant by “ferrets can catch CV, but not in vivo” though? How can a dead (ie., ex vivo or in vitro ) ferret catch ANYHING, aside from maggots perhaps?

    I suppose you mean ‘under natural conditions’ ie., in the wild, they do not catch CV, but I don’t remember reading anywhere that a wild weasel had been found that PCR -tested either positive OR negative for covid.

    • Replies: @anonym25
  124. @Sean

    You are really letting your filthy race hatred flow now, aren’t you, troll? How many ‘Chinks’ (or do you prefer ‘slopes’?)do you happily anticipate being destroyed in your beloved ‘inevitable’ destruction? The more the merrier, eh. There is nothing more hideous that an Exceptionalist Nazi in a genocidal frenzy.

    • Replies: @Sean
  125. @Dave Bowman

    onegrownilliterate. Libertarians are the very bottom of the barrel.

  126. anonymous[198] • Disclaimer says:

    100,000 Jewish children deliberately given fatal doses of radiation in Israel.

    The Ringworm Children–A Jewish Genocide

  127. @Sean

    It could have been a ‘black’ program by the CIA and one of the galaxy of private ‘intelligence’ firms that represent a privatised CIA. Or the Israelis. The USA has 200 bio-labs around the world. collecting pathogens and human DNA and tissue samples. What are they doing?

    • Replies: @ghost of q.mensch
  128. Sean says:

    So just as I can predict that a computer analysis will bear out the strength of a chess move, without being able to perform that analysis on paper, so too can I predict that sooner or later the work of specialists will confirm the hypotheses that COVID-19 was made in a lab and that life on Earth has been shaped by intelligent design.

    It does not matter where Covid-19 came from. Serious mistakes by scientist could have created it that is clear. Even Bat lady admitted it. There is already proof of misconduct by US government employees who recklessly permitted and even paid a totalitarian unfriendly foreign country for what they were warned by eminent experts in the field was unconscionably dangerous research for everyone on Earth wherever on the planet it was done.. All those involved in these reckless decisions over funding the GOF experiments ought to be dismissed, First Fauci and whoever was advising him, and those at the Pentagon throwing money at Duszak’s alliance which was titled as if it was ecologically sound, but was actually the opposite, being instrumental the creation of Frankenstein bugs. Those people need to severely punished by losing their pensions, and subjected to a criminal law investigation.

    • Agree: Johnny Rico, bayviking
  129. @Adrian

    Adrian wrote to me:

    I am a complete outsider in this debate. I was just struck by your vehemence and the disdain you showed for your opponents.

    Awww… did I hurt your feelings?

    You call them “my opponents” as if I am debating them.

    You’re wrong. I am not debating them. I am exposing them, just as I might expose someone I caught embezzling money.

    Adrain also wrote:

    Stephen Meyer’s conversation partners were dismissed as “clowns” – not real scientists.

    Yes, because one of the clowns referred to the three stooges as “scientists” and that is not true. None of the three is a natural scientist.

    Have I mentioned that I truly and deeply hate liars?

    Adrain also wrote to me:

    You tell me that Ard’s argument is undeniable.

    Well… I tell you that anyone of normal intelligence (not you!) can grasp that the three clowns did the wrong calculation. They assumed that evolution randomly creates a new protein do novo out of the space of all possible proteins. That is not what happens.

    The clowns did the wrong calculation.

    I do not believe you are intelligent enough to grasp that basic fact.

    But I think people of normal intelligence can.

    Ard Louis’ paper goes into more detail on that, citing actual scientific research. But I am not suggesting anyone accept him blindly as an authority.

    Adrain also wrote:

    For what it is worth here is a list of seven Nobel Prize winning scientists who either more or less endorsed intelligent design or attacked Darwinian evolution.

    I’ve looked through the list. It is fraudulent.

    For example, the author of the list states:

    Apparently the early founders of quantum mechanics debated the role of the observer. Among them, Wolfgang Pauli and Werner Heisenberg believed that it was the observer that produced collapse – a view which Albert Einstein rejected as too mystical. Pauli happily accepted the appellation, and described quantum mechanics as lucid mysticism.

    Well… that is indeed a description of standard textbook quantum mechanics (from which Einstein dissented). But to interpret textbooks on quantum mechanics as attacks on evolution is just bizarre.

    The author of the list also assumes that anyone who has any philosophical doubts about naive materialism must be anti-evolution. That is just silly.

    For example he states:

    The Wikipedia article, Quantum mind–body problem, provides some useful information on Pauli’s mystical philosophy, which treated consciousness as something irreducible, in contrast to Darwinism, which treats it as a phenomenon of biological origin, which is ultimately reducible to physics and chemistry.

    A tell-tale of a crack-pot here is the reference to “Darwinism” instead of just “evolutionary biology.” We physicists do not refer to “Einsteinism.”

    The mind-body problem is a long-standing philosophical problem that certainly has not been resolved to most people’s satisfaction. Modern biology (including “Darwinism,” i.e., evolutionary biology) is not committed to any specific solution to the mind-body problem, whether naive materialism or anything else. I myself happen to be a harsh and very public critic of naive materialism — I am writing a book on the matter — but of course I do not reject modern biology.

    But all that is irrelevant to the fact that the three clowns in the video made a mistake. They did the wrong calculation. There is no deep philosophical issue involved with the three clowns in the video: they did the wrong calculation.

    Look: you and other goofballs can cite as many pseudo-authorities as you want who may or may not be skeptical towards modern biology. It doesn’t matter: the three clowns assumed that evolution creates new proteins at random out of the space of all possible proteins. But that is not what happens.

    They made a mistake.

    • Replies: @Adrian
  130. Sean says:
    @Mulga Mumblebrain

    Covid-19 (2nd disease in 20 years) and Fentanyl: Wuhan’s deadly gifts to the world, yet China still doesn’t accept it has done anything wrong. On the contrary, they consider themselves hard done by. In the vital easily months, Xi lied to Trump about the pandemic being brought under control in China. It was a deliberate attempt to keep US defences down, and it worked.

    • Troll: d dan
  131. @Mulga Mumblebrain

    Not sure what exactly is the backstory on the apparent friction between you and Sean, and not really interested beyond curiosity, because from what this newcomer to UNZ has read so far, you both seem to share many of the same positions in common overall–positions I generally entertain as being viable as well.

    I think we share the strong suspicion that the Daszak/EcoHealth Alliance ( and many others’) ‘Emerging Virus Vigilance/Biosecurity and Biosafety /DTRA ( Defense Threat Reduction Agency) etc.” biosafety storylines and narratives are for the most part just ‘parallel constructions’ to cover longstanding USG bioweapons prospecting/refining programs behind a cloak of legitimacy, to sell them to Congress in order to justify continued funding of US bioweapons research.

    And when you’ve spent all those $Billions on productive weapons programs , what is the point of not using them when the opportunity arises, and the cause is just…and judged to be worth the risk? Just ask Cheney, Rumsfeld, Mini-me, and their minions and heirs to the fading Empire’s power.

    • Replies: @Sean
  132. @JasonT

    Well, could there be truth to the speculation that something was inserted into the Covid-19 coronavirus that can get triggered by 5G? I don’t know. There was talk in my neighborhood, in Summer 2019, that a 5G tower was to be installed very nearby. Not sure what happened with that.

    Anyhow, the major symptoms were heavy respiratory, initially, accompanied by an exhaustion and delirium like I’ve never experienced. Who can sleep for 30 hours straight? I did (with two short bathroom breaks). I had to check phone, computer and TV to verify to myself what day it was when I finally awoke. 30 hours?!

    A full week completely down, then another 1.5 weeks slowly recovering. Followed by 3 months of intermittent, intense waves of exhaustion where I had to stop what I was doing, lie down and would crash for 2 hours (that’s after a solid sleep the night before!) as well as a heavy, broken-glass cough that lasted 6 months, everything tasted like chalk for a couple months and a few other flaring oddities. I’m 62 and that was unlike anything I’ve ever had.

    I’m sticking with — that it’s a lab-engineered disease, spliced with weird additions and was intentionally released. Ahem, they probably have more of them lined-up.

  133. Adrian says:
    @PhysicistDave

    Adrian wrote to me :
I am a complete outsider in this debate. I was just struck by your vehemence and the disdain you showed for your opponents.

Awww… did I hurt your feelings?

    No , not really. I am too old to be bothered by that sophomoric style of yours. What intrigues me though is why you adopt this bullying approach (of which you give some further examples by your characterisations of my mental capacity – or rather the alleged lack of it).

    A solid argument does not require it. The German philosopher Jürgen Habermas speaks in his magnum opus on “communicative action” about the “non-compelling compulsion of the better argument” (“der zwanglose Zwang des besseren Arguments”). I once wrote a book about this notion of communicative rationality, probably before Dave the Physicists’birth. I see in his style of arguing a deplorable lack of it. He somehow tries to convince by abuse.

    Going somewhat deeper into the matter and looking for reactions to Stephen Meyer I found that this style of arguing is pretty widespread among kindred spirits of his.

    In a generally laudatory review of Meyer’s book Darwin’s Doubt (“Darwinism and Materialism: They Sink or Swim Together”) in The American Spectator od 18 Sept 2013, Kevin Portteus wrote:

    Darwin’s Doubt has also been subjected to a barrage of what can only be called hate. “Mendacious intellectual pornography” is among the more inventive descriptions. Hundreds of negative comments appeared on Amazon review page within hours of the 498-page book’s publication.

    Donald Prothero, a geologist and research associate at the Natural History Museum in Los Angeles, typified many when he said that Meyer is a “fool,” “incompetent,” guilty of “ignorance,” in “way over his head,” with a “completely false understanding of the subject.” Further, Meyer argues “dishonestly,” promotes a “fundamental lie,” promotes a “fairy tale,” and so on.
    Would a scientist make his case that way if he had real arguments? Prothero did attempt a few substantive criticisms, but inadvertently demonstrated that he had not read Meyer’s chapters that had already addressed them. Prothero, in truth, hankers after creationism as his preferred target. But Meyer’s book is devoid of creationism or biblical references. It’s all science.

    The crucial sentence of this paragraph is here: “Would a scientist make his case that way if he had real arguments?”

    The answer is no. I think that people of the Prothero persuasion (and that of Dave the Physicist’s wife apparently) feel that their case is not as watertight as they have always believed. So they attempt to keep the threats at a distance by swearing at them.

    Portteus writes:

    Along with the attacks, we find more and more biologists recognizing that intelligent design (ID) is a serious endeavor. Meyer’s book has been praised by George Church, a professor of genetics at Harvard Medical School; Scott Turner, a professor of biology at SUNY; Russell Carlson, a professor of biochemistry at the University of Georgia and a dozen others. George Gilder, most recently the author of Knowledge and Power, calls Darwin’s Doubt “the best science book ever written.”

    When Thomas Nagel, the Professor of philosophy at New York University, had the audacity to recommend an earlier book of Meyer as book of the year in The Times Literary Supplement of 2009 he was subjected to the same cult like behavior. Alvin Plantinga wrote in The New Republic:

    In 2009 he even went so far as to recommend Stephen Meyer’s book Signature in the Cell: DNA and the Evidence for Intelligent Design, a flagship declaration of Intelligent Design, as a book of the year. For that piece of blasphemy Nagel paid the predictable price; he was said to be arrogant, dangerous to children, a disgrace, hypocritical, ignorant, mind-polluting, reprehensible, stupid, unscientific, and in general a less than wholly upstanding citizen of the republic of letters.

    One expects that style of arguing from a fundamentalist sect rather than from scientists relying on “the non-compelling compulsioof the better argument”. Grand Master Dawkins is not free of it. A colleague of Dave the Physicist, no douibt more illustrious than he will ever be, Peter Higgs, called Dawkins “almost a fundamentalist himself” for his style of arguing (Guardian, 12/27/12).

    O.K. Now go ahead and abuse me some more. I won’t waste any more time on you.

    • Thanks: Vojkan
  134. R2b says:
    @PhysicistDave

    Thank you, but I wouldn’t make to much of those time-periods, projected after Charles Lyell’s uniformitarian layer theory.
    You should rather look at these phenomena, as a certain sedimentation; result after the Great Flood.

    • Replies: @PhysicistDave
  135. R2b says:
    @Leo Den

    Interesting! There are numbers here that do coincide.
    Probably it is a poison, in certain places, under propaganda-cover hyping the annual flu.

  136. @Adrian

    Adrian wrote to me:

    The German philosopher Jürgen Habermas speaks in his magnum opus on “communicative action” about the “non-compelling compulsion of the better argument”

    The fact that you approvingly cite Habermas pretty much says it all, Adrian.

    The problem here is that I have indeed given a compelling, conclusive argument: if you listen to the video, the clowns focus on the idea that out of the entire space of proteins, a random protein is unlikely to be biologically advantageous.

    But evolution does not randomly choose out of all possible proteins. They have done the wrong calculation. Evolution modifies existing functional proteins. And it happens, not surprisingly, that if you have a protein that is already functional, then a modification of that protein, not all that infrequently, is also functional.

    But you really are too ignorant of natural science to grasp this.

    Adrian quotes Kevin Portteus:

    Donald Prothero, a geologist and research associate at the Natural History Museum in Los Angeles, typified many when he said that Meyer is a “fool,” “incompetent,” guilty of “ignorance,” in “way over his head,” with a “completely false understanding of the subject.” Further, Meyer argues “dishonestly,” promotes a “fundamental lie,” promotes a “fairy tale,” and so on.

    Yes, Prothero is quite correct about Meyer, as I have shown.

    Adrian also quoted Portteus as having said:

    Would a scientist make his case that way if he had real arguments?

    Yes, we scientists are not fakers like crit-lit theorists or, well, like Habermas.

    Yes, when someone is a liar or a con artist, we scientists do not see why we should not say so.

    Of course, we do have real arguments showing the liars and con artists are what they are: I have given that argument and its truth is obvious to intelligent people.

    Just not to you.

    Adrian also wrote:

    I think that people of the Prothero persuasion (and that of Dave the Physicist’s wife apparently) feel that their case is not as watertight as they have always believed. So they attempt to keep the threats at a distance by swearing at them.

    No, no need to swear. We point out how we know they are wrong, and that they should know this themselves, and we therefore denounce them as liars, fakers, or con artists.

    Just as we would do with any con artists, embezzlers, etc.

    You seem to think that con artists and embezzlers who have mastered a demeanor that would fit in well in a faculty lounge in a humanities department should not be exposed as the con artists that they are.

    Which says everything about your character, or rather the lack thereof.

    You do not understand at all what science is. In a very real sense, science is the most intolerant system of thought ever created: the whole operating approach of science is to destroy as rapidly as possible bad theories. That is how science progresses.

    Science is not an unending Habermasian discourse. I’ve known a number of Nobel laureates in physics: you would not like them. I liked them.

    One of the true joys of being a scientist is knowing the horror and distaste that we scientists — yes, Dawkins and Prothero and even I myself — inspire in people like you (and, yeah,, people like Habermas and Alvin Plantinga and all the rest of you). Richard Dawkins, by the way, is a very sweet and tolerant fellow, as scientists go.

    Without us scientists, you cannot have your cell phones and your Internet and your antibiotics and all the rest.

    But the world-view that is intrinsic to science is a world-view that has no room for Alvin Plantinga or Habermas… or you, Adrian.

    Most scientists do not know who Plantinga and Habermas are. I do: I’ve even read a bit of what they have written.

    And I despise them.

    (I actually rather like Thomas Nagel, though. I do not hold him responsible for some of the silliness in which he engaged, to which you allude, in his old age.)

    Science is still only a bit over four centuries old. Human cultures have yet to really absorb or accept the results of science.

    But when they do… well, I am pretty sure that you and Habermas and, most especially, Alvin Plantinga would all much rather be dead than live in a society that has fully accommodated the results of natural science.

    A thought that I find incredibly cheering, almost as cheering as that beautifully uplifting poem by Matthew Arnold: I refer of course to “Dover Beach.” The cultural sea of Plantinga, Habermas, and you, Adrian, is indeed retreating into the past with a melancholy whimper.

    • Replies: @Brás Cubas
    , @Sean
  137. @R2b

    R2b wrote to me:

    You should rather look at these phenomena, as a certain sedimentation; result after the Great Flood.

    Okaaay, as I slowly back away and look around frantically for an exit from the room.

    Tell me you’re just making a little joke, eh?

    If you’re not: two words — radiometric dating. It’s physics, man.

    • Troll: R.G. Camara
    • Replies: @R2b
  138. anonym25 says:
    @ghost of q.mensch

    I have found this science report very relevant to the question asked by Sean. Seemingly, ferrets can transmit airborne viruses between each other. There was a controversial biological experiment carried out by Yoshihiro Kawaoka and Ron Fourier back in 2014 which precisely prompted the ban on Gain-of-Functions by the Obama administration.

    https://www.sciencemag.org/news/2019/02/exclusive-controversial-experiments-make-bird-flu-more-risky-poised-resume

    https://www.sciencemag.org/news/2011/11/scientists-brace-media-storm-around-controversial-flu-studies
    .
    Ron Fouchier is one of the names that you can find in Fauci’s email exchanges. All of them have been somehow redacted.

    When it comes to Yoshihiro Kawaoka, he pioneered the use of HIV splicing in flu-like virus according to his september 2011 article. He uses a particular HIV protein to speed up the virus replication process inside an infected cell. Here is the article:

    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3165756/

    • Thanks: ghost of q.mensch
    • Replies: @Sean
  139. skrik says:
    @bayviking

    Thanks again; looks like your ‘Latham&Wilson’ is a later version than mine, while my evaluations continue, here is an ‘image of some interest:’
    rgds

  140. Sean says:
    @ghost of q.mensch

    The Covid-19 pathogen is exceptionally stable for an RNA virus, because its RNA enzyme has a proofreading function. The first three Covid-19 cases outside China were in Nepal and Thailand and were (19A). The first mutant (19B) revealed by genetic sequencing was reported in Yunnan on January the 17th 2020. The same (19B) one was reported in the USA two days later. The 19B mutation obviously occurred in China during the latter months of 2019. The original 19A virus is mainly confined to Asia. Taiwan knew the CCP for what they are, and completely distrusting that the Chinese government or its poodle the WHO would tell Taiwan what they needed to know, it began infectious disease checks on flights from mainland China on Jan 1st.

    Taiwan has has seven COVID-19 deaths in a population of 25 million. China provided information that led the WHO to give a press briefing on Jan 14 in which they said “it is certainly possible that there is limited human-to-human transmission” . [emphasis added] Also on Jan 14, the WHO tweeted that so far the investigations by Chinese authorities had found “no clear evidence of human-to-human transmission”. You couldn’t fly from Wuhan to Bejing, because China had locked down all domestic traffic by the end of January 2020, but through the WHO insisted on other countries permitting flights from China. By that point Xi knew enough to see the pandemic as offering a way to get rid of Trump Chinese sanctioning his key states’ agricultural products was hardly a sign they would be punctilious in preventing covid spreading to the US and wreaking havoc on Wisconsin dairy farmers ECT

    • Thanks: ghost of q.mensch
    • Troll: d dan
  141. R2b says:
    @anon

    CB940 is kind of a straw argument, cause why would creationists burden a concept, ”natural selection”, they don’t believe in, with the concept of chance.
    A meningless proposition.

    Not by chance, relates rather to abiogenes, which creationists obviously do not believe in.

    CA620 is a wholly other type of question, namely existential, not scientific, which is the present topic.

  142. @Dumb4asterisks

    This argument from Richard Dawkins concerning the giraffe’s laryngeal nerve, as well as many of the counterarguments thereto, is philosophically inept.

    What most people on either side of this debate seem not to realize is that no mere anatomical fact about an organism proves anything either for or against Darwinism, or Intelligent Design, or Creationism. Such facts are meaningless in and of themselves. They prescind from the only relevant question here, viz. “Are living organisms something that can be assembled from nonliving pieces by a mechanistic process?” If the answer is yes, then living organisms may either be the constructions of a powerful mind (e.g. Intelligent Design) or the outcome of stochastic forces acting over ages of geologic time (e.g. Darwinism, aka “Unintelligent Design”), and it makes little difference either way—they are both equally materialistic.

    But living organisms are not the material constructions of either intelligence or epochs. The living organism is monadic, something irreducibly simple which belongs to a category of being in which it is itself the fundamental, the prime fact, the ne plus ultra. Within this category, living things cannot be divided or reduced to simpler components. There is no such entity as half a dog or a third of a turtle; something is either alive as such-and-such a living form or it is not alive, period.

    Therefore the answer is no. And if living things are not constructions, then they can only be brought into existence by what was classically called a “power of generation,” which might mean either the direct creation by God or at least the transmission of a monad (i.e. a soul) from another being. It is, by definition, not possible that a living thing can have any other origin than this.

    I have explained all of this at length in a guest post published here at this very website.

  143. Sean says:
    @anonym25

    Virologist Robert Redfield explained his belief Covid-19 stemmed from a lab leak relates to the transmissibility of the Covid-19 virus being extremely high, which is quite inconsistent with a recent natural origin in a jump from bats, but what one would expect from a pathogen subjected to standard virology techniques.

    Nature 2013 Simon Wain-Hobson:If aerosol-transmitted virus is systematically passaged from ferrets with severe respiratory distress, then the research teams will end up with a transmissible and highly virulent strain. Likewise, if animals with mild symptoms are chosen, a transmissible virus of low virulence would ultimately emerge. Whether nature will take any of these courses is unknown. Take dog breeding. Ruthless selection of alleles over a short period has produced phenomenal phenotypic variation — dachshunds, salukis, whippets and setters. Would nature have come up with the dachshund?

    Gain of Function is not a standard technique, it is actually producing a new pathogen and use of it on influenza led to a moratorium, which Wain-Hobson points out the researchers themselves decided to lift in 2013. In 2014 after series of embarrassing biosafety incidents at Federal labs the US government agency banned GOF [“moratorium and funding pause on any dual-use research into specific pandemic-potential pathogens (influenza, MERS, and SARS)”]. However Baric (University of North Carolina at Chapel Hill) had already began one such and was allowed to continue with it. When it was published there was uproar because he had tweaked on a bat coronavirus and revealed that it was one humans could catch.

    “In order to study it in a lab, scientists have created a hybrid version of a virus that could be the world’s next pandemic — a SARS 2.0,” Vice Magazine (2016)

    The science community swung behind the forty or so scientists who wanted to restart doing this work and the argument was the ban on GOF was preventing vitally necessary research for devising vaccines fight an outbreak. The contention of the GOFers and those who assumed they knew what they were talking about (despite obvious conflict of interest) was that to prevent a pandemic the GOF had to be allowed. Meaning, it had to be funded. It was also emphasised that Baric’s GOF study had not resulted in a virus that could be at all easily caught by a human from another human, and so there was no danger of a pandemic. Baric’s collaborators included Xing-Yi Ge and Zhengli-Li Shi of the Wuhan Virology Institute, which is how Batic got the virus, Bat Lady had had been going to remote caves in Yunnan netting bats and and sampling bat viruses.

    Collins, Francis S. (19 December 2017). “NIH Lifts Funding Pause on Gain-of-Function Research”. Director, National Institutes of Health.

    The rationale being G-o-F was “important in helping us identify, understand, and develop strategies and effective countermeasures against rapidly evolving pathogens that pose a threat to public health.”

    Let us review the question Wain Hobson asked and not just about G-0-F “Whether nature will take any of these courses is unknown. … Would nature have come up with the dachshund?”.

    • Replies: @Sparkon
  144. R2b says:
    @PhysicistDave

    Easy now, don’t panic.
    I anticipated that answer.

    Sure, it’s physics.
    Radiometric dating, however, is not waterproof.

    It’s subjective to the same uniformitarian expectancy as for the geological layers.
    It is to the contrary very possible, that radioactive decay has had a somewhat different rate.

    You know, phenomena and forces, observable today, are not necessarily the same as, well lets say a long time ago.

    • Troll: nokangaroos
    • Replies: @PhysicistDave
  145. anonym25 says:
    @Sean

    All the governments knew that a deadly virus was circulating in Wuhan as early as november 2019. There is this famous israeli intelligence report that shed light into this as they obtained the intel from the US itself as early as that.But most importantly, they knew because their soldiers got infected by the virus at the Wuhan Military Games back in october 2019. Not only were they infected, but also some of them died. Biden slipped this inconvenient truth back in a september 2020 rally stating that as many as 6000 US soldiers died from the virus. The media immediately fact-checked his assertion by alleging that only a hundred soldiers died instead.

    Trump was asking Xi to let him investigate how this biowarfare attack was carried out in late december 2019 and early january 2020. Xi, however, didn’t trust Trump enough and politely denied Trump’s request. From that point on, it was clear to the Trump administration that no real inquiry over this would be carried out and Trump, instead, put all the blame on China for the virus.

    In reality, both Trump and China were mainly the victims of this biowarfare. As many have suggested here, Wuhan is a huge transportation hub across which millions of Chinese roam during the Chinese New Year. It’s the perfect occasion to strike China with a bioweapon to completely weaken her as the Chinese travelers would be spreading the virus all across the country, infecting and killing a few millions of Chinese along the way.

  146. @Sean

    Nicholas Wade has said “the idea that the virus might have escaped from a lab invoked accident, not conspiracy”.

    Wade is wrong. Granted, perhaps there was no conspiracy involved in the outbreak of CoViD-19 and all that happened was simply a lab-related accident. The conspiracy would have been the cover-up of that accident.

  147. @R2b

    R2b wrote to me:

    Sure, it’s physics.
    Radiometric dating, however, is not waterproof.

    It’s subjective to the same uniformitarian expectancy as for the geological layers.
    It is to the contrary very possible, that radioactive decay has had a somewhat different rate.

    No, it’s not.

    Learn some science, young fella.

    At least you’re not as rude as that jerk Adrian!

    • Troll: R.G. Camara
    • Replies: @R2b
  148. Sparkon says:
    @Sean

    Nature might not have come up with the dachshund, because nature already had the badger, but nature did come up with the (duck-billed) Platypus.

    British scientists’ initial hunch was that the attributes were a hoax. George Shaw, who produced the first description of the animal in the Naturalist’s Miscellany in 1799, stated it was impossible not to entertain doubts as to its genuine nature, and Robert Knox believed it might have been produced by some Asian taxidermist. It was thought that somebody had sewn a duck’s beak onto the body of a beaver-like animal. Shaw even took a pair of scissors to the dried skin to check for stitches.

    — Wikipedia

    As for SARS-CoV-2 and COVID-19, isn’t it at least possible that a human became infected with coronaviruses from bats and pangolins simultaneously?

    Scientists at the Francis Crick Institute have found important structural similarities between SARS-CoV-2 and a pangolin coronavirus, suggesting that a pangolin coronavirus could infect humans.

    https://www.sciencedaily.com/releases/2021/02/210205121245.htm

    A to-be-published joint study from the World Health Organization (WHO) and China states that transmission of SARS-CoV-2 from bats to humans most likely occurred through another animal. […]

    The report, acquired as a draft by the Associated Press, is largely based on a WHO investigator visit to Wuhan from mid-January to mid-February this year. The investigators detailed 4 scenarios by which SARS-CoV-2 could have emerged, listed in order of most likelihood to least:

    • Bats through another animal (very likely)
    • Direct spread from bats to humans (likely)
    • Cold-chain food products (possible but not likely)
    • Laboratory leak (extremely unlikely)

    https://www.contagionlive.com/view/who-china-report-covid-19-passed-bats-humans-animal

    • Replies: @Sean
    , @Brás Cubas
  149. @Adrian

    I daresay PDave – as usual the only adult in the room – was gracious enough
    (referred to as “like talking to a sick horse” heresaround).
    Do not know Prothero, but clearly he is holding back also; geologists are a level-headed bunch (if I say so myself) … it´s a “big picture” thingy.
    They even shredded Tollmann* when his kidney failure began to show in his writing –
    like a pack of wolves (and his creds were above what any here can aspire to);
    for this is the Way and the Method.

    – The “ivory tower” is a pit of bloody sand … not everything that happens there is pure, but in the long run all the results are.
    Everybody – and I mean everybody – is free to jump in; but if you bring fourth-grade maff to a problem that can at best be circumscribed in vitalist terms (haram!, I know),
    do not be taken aback when you are laughed off at the gate by unwashed undergraduates. There are no points for “style”
    (“victrix causa deis placuit; sed victa Catoni“).

    The argument of the snake oil persons (or, if you prefer, these paragons of Mark 9:42)
    is ever the same:
    Wah, the oh-so-secret misunderstood genius unfairly put upon by those incompetent, envious eggheads jealously guarding their ill-gotten sinecures; it´s an appeal to ressentiment as cheap as it is misguided (and pathetic).
    AFAIK outside the US the method was popularized by Däniken –
    within the US itself of course the tradition of Cotton Mather is unbroken
    (and watching them wax profound on “Islamic anti-intellectualism” is a steady fount of hilarity).

    The disheartening part is these bed-wetters still find listeners …
    Dawkins´stated motive is that science denial is dangerous – and (I might add)
    it doesn´t matter jack whether it´s anti-racist or dispensationalist.
    – At this point in the US it is customary to quote P.T. Barnum.
    Prof. Erben, always the gentleman, preferred the Arab saying
    “camels drink from muddy wells also”.

    *As a maybe interesting aside Tollmann was a big fan of Genesis, from the other side:
    Of course there can be no god, but the similarities to (and the characteristic deviations)
    what actually happened are intriguing.

  150. Sean says:

    Wuhan is a huge transportation hub across which millions of Chinese roam during the Chinese New Year. It’s the perfect occasion to strike China with a bioweapon to completely weaken her as the Chinese travelers would be spreading the virus all across the country, infecting and killing a few millions of Chinese along the way.

    Beijing is a bigger one, but Wuhan is known as China’s research centre for virology and the world centre for research into bat coronaviruses; the US Embassy had reported in 2018 that Bat Lady’s team had found three potential pandemic bat coronaviruses in a Yunnan cave and were studying them in their recently built highest biosafety rating containment facility. Hence if Covid-19 is a planned use of a bat coronavirus tweaked into a bioweapon by an American cabal from the Deep State, Wuhan would have been chosen to frame China for a lab leak. However, Wuhan is seven hundred miles from the Chinese capital, and to not be an obvious bioweapon attack the cabal needed to have a slow burning outbreak in Wuhan, which would entail time for the Chinese to spot the contagion and impose a quarantine on Wuhan and country wide hygienic measures.

    The bioweapon attack would have to have been intended to hit Beijing hard if the objective/priority was to set China back substantially. They were trying to design a bioweapon attack that would be impossible to trace back to the US and would look to everyone–even the Chinese–as if Bat Lady had a lab leak. However to have the pandemic begining in Wuhan and h yet still decimate Beijing it would have had to be extremely transmissible making a global pandemic inevitable. Hence covertly and convincingly faking a natural spread from an apparent lab leak in Wuhan would provide time for countermeasures to prevent the infection reaching Beijing from a slow start in Wuhan makes using an super infectious virus would be necessary. In a nutshell because China has thermonuclear ICBMs, attacking it with a bioweapon would entail accepting a world wide pandemic.

    But this strange conclusion is only necessary if we assume the goal of the whole thing was severely weakening China relative to America; that may not have been the aim at all. Filling hospitals with elderly people is not going to hurt an economy like China’s any more that America’s, and realistically a modern state could shut down non essentially services without lasting damage and develop a vaccine after a year. If all advanced countries were in the same boat there would be would be no terribly significant relative advantage, or disadvantage. What possible other objective could there be for an American cabal to clandestinely cause a pandemic starting in China but spreading to the rest of the world? Getting rid of Trump. If Covid-19 was a bioweapon out of the depths of the American Deep State then what was on the minds of the top men was preventing another term for him in the White House, which would otherwise have been inevitable. Xi would not need to be brought into the scheme, but in any case he could be counted on to make things as bad as he possibly could for America by duping into not bringing travel restriction in timeously, for as long as that dissimulation retained plausible deniability for himself and China.

    The American secret agents who actually carried out the operation would not know–even if aware it was a bioweapon–that the virus was really intended to cause a pandemic killing hundreds of thousands of Americans, The cover story for levels immediately below the real decision makers (the covert operatives of the cabal) would be something that decent patriotic Americans could get behind , such as this was for China’s own good and was the only was to stop the Communist Chinese dominating the world in a generation and so Trump had been left with no option except to issue a secret command for it. was probably that the Chinese would be extremely vulnerable to it, but Europeans hardly at all and so it would not spread out of China in any sustainable way. Only a select few at the very top would know. Of course the field agents–likely all liquidated by now–would have believed that this was a legal chain of command operation, properly authorized by the elected President.

    • Replies: @Brás Cubas
  151. Sean says:
    @Sparkon

    Cold-chain food products (possible but not likely)

    It would be a first in medical history for a respiratory virus to be transmitted that way (completely impossible).

    Direct spread from bats to humans (likely)

    We know that can happen, but according to Redfield it is most unlikely that immediately after such a jump the virus just arrived in humans would have the very, very high degree of sustained transmissibility between humans which the Covid -10 pathogen exhibited from the get go (it would not have caused a pandemic). Virologist Redfield has said the human–human transmissibility of the Covid-19 virus being extremely high right out the gate , indicates the pathogen was subjected to standard virology techniques. From what I can make out, others are insinuating the amping up of the Covid -19 pathogen’s transmissibility was done using humanised mice rather than ferrets for the passaging.

    Bats through another animal (very likely)

    There were 47, 000 animals sold in Wuhan but no bats, however some recent research has cast doubt on pangolins and civets being a vector or virus intermediary between bats and humans

    https://www.eurekalert.org/pub_releases/2021-05/uonc-ucr050421.php
    NEWS RELEASE 4-MAY-2021
    UNC Charlotte researchers analyzed the host origins of SARS-CoV-2 and other coronaviruses[…]
    [R]ushed analyses to understand the origins of coronaviruses in humans. This rush has led to a thus far fruitless search for intermediate hosts (e.g., civet in SARS-CoV and pangolin in SARS-CoV-2) rather than focusing on the important work, which has always been surveillance of SARS-like viruses in bats.

    As Professor Wain-Hobson said several years ago “virologists are going down a blind alley and the powers that be are blindly letting them go down that alley, which is tantamount to acquiescing. So let’s be clear: the end game could be viruses more dangerous than the Spanish flu strain”.

    Nature might not have come up with the dachshund, because nature already had the badger, but nature did come up with the (duck-billed) Platypus.

    What man has wrought on the wolf to turn it into the wiener dog could be done to the platypus very easily.

    Professor Wain-Hobson’s analogy was wolves, and deliberate human intervention of their reproduction so as to get the set of desired characteristics such as Dachshunds is not something that ought to be a part of virology under the guise of anticipating what ‘fast evolving ‘ nature might come up with. While that would be possible in wolves under purifying selection in the wild, at least theoretically, in practice it could not happen because the odds are astronomically against it. So virologists are doing it for no good reason.

    • Replies: @Sparkon
  152. skrik says:
    @bayviking

    Preliminary analysis of your cited ‘Latham&Wilson’ article:

    1. The operative keywords are “the Mojiang Miners Passage (MMP) hypothesis.”

    2. What’s really new is in an article Latham&Wilson cite, namely in here, wherein they identify an RRAR|S furin-cleavage site [precise location indicated by the “|”] “on the human epithelial sodium channel α-subunit (ENaC-α)”, work remaining to be done here is a) for me to find this subunit’s sequence (to check for CGG codons) and b) for somebody to identify exactly *how* CoV-2 may have ‘acquired’ its PRRA insert [possibilities still wide-open are a) some form of ‘recombination’ vs. b) having been ‘shoved in’ by some agent’s hands.]

    3. What’s missing is any description of how CoV-2 may have ‘acquired’ its pangolin-sourced RBM (part of the RBD in the spike.)

    Notes: I already ‘located’ these items in the PhD thesis:

    At point II/14, WIV is mentioned in context with “The patient tested positive for Serum IgM”

    At point III/3, Dr Shi is reported as concluding in 2005 that “SARS-like-CoV carried by bats is not contagious to humans” but this assessed in the documentcloud paper as “This contradiction…”

    In IV Conclusion, some “SARS-like CoV” carried by bats is implicated in the 6 infections.

    [More when/if I find a sequence for ENaC-α.] rgds

  153. skrik says:

    correction: “PhD thesis” = “Master’s thesis”

  154. @Sean

    Listen Bullshit Boy, the CCP are what they are, the most successful political party and governing force in history. If you prefer the compradore, ‘honorary Whites’ of the Taiwan elite, I’m not surprised. And the WHO is the poodle of Gates et al and Western BigPharma, no-one else. Your pathopsychological projection is painful, and your racist contempt and delusions of superiority simply pathetic.

    • Replies: @Sean
  155. @Sean

    What about the infamous National Center for Medical Intelligence (NCMI) report, which ABC News, and the Israeli TV, said existed and alerted everyone of the impending catastrophe in November 2019? Why would that report have been released if the attack’s blowback was a secondary goal? Or do you think that story was fiction?

    • Replies: @Sean
  156. @PhysicistDave

    Without us scientists, you cannot have your cell phones and your Internet and your antibiotics and all the rest.

    LOL, next you are going to complain about your government pension.

    How about going back on-topic and debating whether we would have pandemic-generating lab incidents without you scientists?

    • Replies: @PhysicistDave
  157. Sparkon says:
    @Sean

    What man has wrought on the wolf to turn it into the wiener dog could be done to the platypus very easily.

    I‘m happy to be the one to break it to you Sean. The dog didn’t evolve from the wolf.

    It turns out that today’s dog breeds may not have evolved from the gray wolf, at least not the kind of gray wolf that exists today.

    A study in the current issue of PLoS Genetics suggests that, instead, dogs and gray wolves share a common ancestor in an extinct wolf lineage that lived thousands of years ago.

    https://www.csmonitor.com/Science/2014/0117/Did-dogs-really-evolve-from-wolves-New-evidence-suggests-otherwise

    What you think than crappy cartoon proves is beyond me.

    Typically, you wrote a wall of text, but dodged my main point, i.e. that a human could have been infected by coronaviruses from both bats and pangolins at the same time.

    Maybe someone else will reply succinctly.

  158. Sean says:
    @Mulga Mumblebrain

    [T]he CCP are what they are, the most successful political party and governing force in history.

    They have control of China, but given the economies of scale it was always a sleeping giant. Sticking with the metaphor, China and the West are like the dragon with the donkey hook up from Shrek, because China is just too big and dynamic; climbing to ever greater heights of efficiency in the sense of cost effectiveness, but without creativeness as in the West where failure is permitted. Still China does not need to innovate if they are being given the wests crown jewls. I don’t think anything would have been much different if it had been the Nationalist who won and became the central government. China is a vast and growing market Western big business can invest, and exponentially increase their share price in; sometimes even make and be permitted to repatriate profits. But the productive capacity is all remaining in China. Elon Musk will find out what Alain Mérieux already has.

    The strange saga of how France helped build Wuhan’s top-security virus lab
    MAY 31, 2020BY KARL LASKE AND JACQUES MASSEY
    The maximum-level biosafety laboratory at the Wuhan Institute of Virology was the first of its kind to be built in China, and has been the center of huge speculation since the start of the Covid-19 pandemic which originated in that city. The laboratory, which is equipped to handle Class 4 pathogens (P4) including dangerous viruses such as Ebola, was built with the help of French experts and under the guidance of French billionaire businessman Alain Mérieux, despite strong objections by health and defense officials in Paris . Since the laboratory’s inauguration by prime minister Bernard Cazeneuve in 2017, however, France has had no supervisory role in the running of the facility and planned cooperation … despite the fact that France helped build the facility and that Paris and Beijing signed an agreement on future cooperation and collaboration,

    Giving the Chinese invaluable technology gratis, and then getting kicked out. The productive capacity being built in China by Western investment and technology transfer is not something the West will own in any meaningful sense. But business owns politics and that is why the corporate media, by and large, are favourable to China and loathed Trump who started to difficult process of restoring a realist policy toward China . The New York Times’s reporting on the origin of the Covid-19 pandemic shows the kind of bootlickers they truly are. Trump warned about China and the Covid -19 pandemic proved him right, but in the NYT all you will read is him and Redfield being blamed for the pandemic deaths, whatever the Wuhan lab origin bien pensants like Mcneil are beging to backhandedly accept is possible.

    And the WHO is the poodle of Gates et al and Western BigPharma, no-one else

    The only thing corporations and billionaires concern themselves with is avoiding tax. Gates is an excellent example of how it is done by putting their money in a non profit foundation. Ostentatious charitable contributions, such as Gates is known for, are an essential part of any personal tax-avoidance scheme. Corporations use fictitious bases for their operation in Ireland and other freeloader counties. The state Biden represented was Delaware, which is where most Fortune 500 companies are (on paper). He is a corporate front man and may now be talking about “extreme competition”, but a couple of years ago he incautiously said what he thought.

  159. skrik says:
    @Sean

    “The video shows bats being held in a cage at the Wuhan Institute of Virology, along with vision of a scientist feeding a bat with a worm.”

    Except that there is *zero* evidence presented to ‘indicate’ let alone ‘implicate’ WIV as bat-keeper, besides which, that would be totally beside the point.

    In this video, Sky News Australia = (((propaganda))) [Always and as usual, IMHO.]

    RaTG13 and the MMP hypothesis both came out of a bat-cave, over 1000km from WIV; AFAIK very few people dispute that WIV was ‘on the job’ of bat/CoV investigations, BUT#1:

    1. ‘He who pays the piper calls the tune,’ namely here Daszak&EcoHealth, Fauci&ZUSA.

    2. The current corrupt&venal MSM+PFBCs ‘pushed narrative’ is that China ‘dunnit by accident’ BUT#2:

    What the lamestream media push is 99.9% likely to be the exact opposite of reality, and the real point is not who built the SARS-CoV-2 chimera, but how, when & from where it ‘escaped’ OR [far more likely] was deliberately released.

    I say the villains are 99.9% likely to be those who have demonstrated ‘form.’ rgds

    • Replies: @Sean
  160. @Sean

    Interesting video with newly expanded video evidence from the DRASTIC group. Note that Marion Koopmans (WHO inspector and a co-author of the high criticized/easily manipulatable 01/23/20 Corman-Drostan covid rtPCR test),

    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6988269/

    was also in on that video conference clip with Daszak.

    Please keep in mind the SKY News TV person applies Murdock Aussie outlet’s predictable strong anti-CPC government ruling faction, pro-Falun Gong opposition bias to the new information.

    I doubt we will ever see any Murdock outlets calling out Fort Detrick or any of the hundreds of US supported bio-security labs to open up their facilities and records for inspection.

    • Replies: @Sean
  161. @PhysicistDave

    Thank you for the link. The article speculates about possible solutions to one of the problems Meyer describes, but obviously doesn’t solve them. On the contrary, the wild mishmash of speculations underlines the gravity of the problem. It is not even close to the kind of clearly-written systematic refutation I’m looking for.

    Find me a book or article by a good science writer (not a specialist in a technical journal) who can write as well as Meyer and who attempts to refute him.

    Meyer summarizes what he claims are the extant Darwinian counter-arguments clearly, and refutes them cogently. Why can’t Darwinians write with the same clarity?

    • Replies: @PhysicistDave
  162. Sean says:
    @ghost of q.mensch

    Murdock Aussie outlet’s predictable strong anti-CPC government ruling faction

    I hate Murdoch and his hirelings, but at least he is not taking it up the ass for China like the entire MSM and so called alternative voices are doing. Wade decided to bring it all down because he was suffering unbearable humiliation

    Fort Derrick had being going to remote caves and collected fifteen thousand samples from bats with potentially novel coronaviruses on them did they? If you collect enough bat coronaviruses, sooner or later you’ll find one that can infect humans. Robert Redfield explained the methods that scientists use to study viruses involve increasing their transmissibility.

    The most obvious is the spike protein that functions as a key to unlock the human cell. The odds that such a perfect “key” to a very complex “lock” would emerge naturally out of random processes might seem, at first glance, prohibitively low. To quantify the odds, one would have to know how many random mutations would have to occur to transform the key to bat cells into a key to human cells. One would also have to know the combinatorial space determining the odds that each mutation could enhance the virus’s prospects of building a key for unlocking human cells. Finally, the odds of each “beneficial” mutation’s happening to work well with other such mutations would need to be calculated.

    Standard virologic techniques of passaging the virus through lab animals such as Simon Wain-Hobson discussed several years ago in his talk that I linked to above, would be a low tech way a bat coronvirus have its transmissibility increased. That would give scientists who scoffed at a lab engineered Covid-19 pathogen an ‘out ‘because the virus itself might not have been engineered. (Paul Ewald expressed fears that the concentration camps in Wuhan where people are crowded together in unhygienic conditions could produce a more virulent strain of Covid-19).

    However, there remains the issue of the mice engineered to have receptors similar to human cells which Wuhan scientists had used in research into coronaviruses when working with Baric in 2015, heavily criticised by Wain-Hobson at the time. If those hunanised mice were used to passage a somewhat human-infective bat coronavirus that would completely explain why the Covod-19 pathogen acquired such freakish human-human transmissibility so soon after leaving a bat

    • Replies: @Sean
    , @ghost of q.mensch
  163. @Sparkon

    As for SARS-CoV-2 and COVID-19, isn’t it at least possible that a human became infected with coronaviruses from bats and pangolins simultaneously?

    For what it’s worth, Wuhan markets did not sell pangolins (nor bats, but that had already been established):

    Animal sales from Wuhan wet markets immediately prior to the COVID-19 pandemic
    https://www.nature.com/articles/s41598-021-91470-2

  164. Sean says:
    @Sean

    Bioessays. 2020 Aug 12 : 2000091.
    doi: 10.1002/bies.202000091 [Epub ahead of print]
    PMCID: PMC7435492
    PMID: 32786014
    Might SARS‐CoV‐2 Have Arisen via Serial Passage through an Animal Host or Cell Culture?
    A potential explanation for much of the novel coronavirus’ distinctive genome

  165. @Sean

    However, there remains the issue of the mice engineered to have receptors similar to human cells which Wuhan scientists had used in research into coronaviruses when working with Baric in 2015,

    Hey, It’s a brave new world. You probably know that genetic “knock-outs” and transgenic animals are widely used laboratory research tools and test models in use since the 1990’s.

    The humanized ACE2 receptor bearing lab mouse “K18-hACE2” strain was first published in 2007, (see INTRODUCTION lines 50-135) in pdf linked paper galley proof below:)

    https://21a86421-c3e0-461b-83c2-cfe4628dfadc.filesusr.com/ugd/659775_a00d8cadc76349f3a859ee73cf1bcee5.pdf

    It is a very widely used animal model employed in probably hundreds or even thousands of academic and commercial labs for investigation of a broad range of legitimate medical research questions involving the important ACE (angiotensin converting enzyme) system. This particular humanized mouse strain probably has been available commercially for anyone to buy from lab animal breeders like Jackson Las or Cold Spring Harbor Labs, (hell, maybe even from AliBaba/Amazon nowadays? Like I say, it’s a brave new world!) for some time a.

    IMO, if that particular strain of humanized mice were being housed in WIV, it was probably there to test virulence of new nasty bugs that China’s surveillance teams had picked up, and suspected of having been spritzed about inside their country by some bad actors, were part of the SARS.x class of coronavirus series of ACE2 receptor-binding BW agents.

    • Replies: @Sean
  166. R2b says:
    @PhysicistDave

    Thank you.
    But with a no, you do not convince me.

    First there is problems with knowing the initial conditions for the rocks, being measured.

    Second is the problem of contamination; rocks are not closed systems.

    Thirdly, there is surely the problem with constant rates of nuclear decay.

    You can not reproduce conditions, just assume them, considering these vast time-spans. And problem goes alike for just some thousand of years, as for larger amounts.

    Uniformitarianism is, as I see it, the basis of evolutionary thinking, and that is just an assumption, not scientifically verifiable.

    • Replies: @PhysicistDave
  167. Tdstype2 says:
    @PhysicistDave

    Agree. Plus, ID is logically inconsistent- if complex things Must have been “ intelligently designed”, how did the “ intelligent designer” came about?

    • Replies: @anon
  168. Sean says:
    @ghost of q.mensch

    In Nature 2013 Simon Wain-Hobson asked “If aerosol-transmitted virus is systematically passaged from ferrets with severe respiratory distress, then the research teams will end up with a transmissible and highly virulent strain. … Whether nature will take any of these courses is unknown.”

    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7435492/
    The long‐standing practice of serial passage is a form of gain‐of‐function research that forces zoonosis between species, and requires the same molecular adaptations necessary for a natural zoonotic jump to occur within a laboratory, leaving the same genetic signatures behind as a natural jump but occurring in a much shorter period of time. […]. However, the artificial generations added by forced serial passage creates the artificial appearance of evolutionary distance… and is exactly what is found with SARS‐CoV‐2, which is distant enough from any other virus that it has been placed in its own clade. […] These findings all point to the possibility that SARS‐CoV‐2 may have gained its furin cleavage site the same way influenza viruses do—through the in vivo serial passage between the live hosts that presents the immune challenges and intense selective pressure necessary for the recombination and mutations that lead to its emergence to occur. And just like influenza viruses are only able to preserve their furin cleavages in artificial environments since the heightened virulence they impart kills their hosts before they can propagate in a natural setting, based on the known taxonomy lineage B coronaviruses do not appear to be able to support furin cleavages in nature.

    • Agree: ghost of q.mensch
    • Replies: @ghost of q.mensch
  169. @Sean

    Sean,

    I know Sabine, of course, and she and I are largely in agreement about the “problems in physics.”

    Of course, all physicists agree that dark matter and quantum gravity are puzzles. The big issue is the so-called “measurement problem” in quantum mechanics: I have thought this was a major problem for over fifty years, and, I am happy to see younger physicists like Sabine, and even some senior people in the field, such as my former professor Steve Weinberg, agreeing with me.

  170. anon[184] • Disclaimer says:
    @Tdstype2

    Plus, ID is logically inconsistent- if complex things Must have been “ intelligently designed”, how did the “ intelligent designer” came about?

    How did anything come about?

    Which is more difficult to come about: man or F-16?

    So, F16 possible by evolution/nat selection?

    I don’t know.

    bjondo

  171. @Brás Cubas

    Brás Cubas wrote to me:

    How about going back on-topic and debating whether we would have pandemic-generating lab incidents without you scientists?

    Becuase the goofball who wrote the original post, our pal Kevin, chose to combine the issue of Intelligent Design with the Covid issue. And then other goofballs here got angry when I pointed out the obvious math error made by the clowns in the video that Kev embedded.

    Don’t blame me: blame the goofballs.

    Look: Kevin asked me to provide actual reasons and evidence showing that the clowns are wrong. I have done so, at a level that any human of normal intelligence (i.e., not some of the commenters here or, it seems, Kevin) can grasp. The clowns did a calculation for the problem where evolution creates a new protein de novo out of a random sequence of amino acids: that is not what happens.

    In fact, evolution modifies an existing protein that is already functional in some way. That is a very different situation from the one the clowns addressed.

    They did the wrong calculation.

    As it happens, yesterday I picked up off the shelf in our local public library a book by the evolutionary biologist Andreas Wagner, Life Finds a Way. Chapter 4 of the book is directly relevant to the argument here.

    From the penultimate page of that chapter, where Wagner sums up:

    When nature recombines genomes, and when biotechnologists recombine molecules, they do not make completely haphazard changes to DNA. Instead, they take organisms or molecules that already work well — we know, because they have survived to this day — and mix up their parts. It’s as if you exchanged the pages of two texts that tell a similar story but in different words. Such recombination will not always improve the text, but it will not usually destroy its meaning completely, and could even create unexpected twists or new plotlines.

    Yes, that is what happens: evolution alters existing functional proteins, which is not what the clowns in the video calculated.

    This is a test of the ethical integrity of Kevin Barrett. He asked me to justify my claim that the clowns were wrong. I gave a straightforward explanation that anyone of normal intelligence can grasp. I linked to an online paper that is quite readable. And now I have given a reference to a book, published just a couple years ago, that discusses the matter in detail.

    Does Kevin have enough honesty or integrity to admit that the clowns are clowns?

    I don’t think so.

    But let him prove me wrong.

    • Replies: @Brás Cubas
  172. @R2b

    R2b wrote to me:

    Thirdly, there is surely the problem with constant rates of nuclear decay.

    No, that is not a problem. Your ignorance of science is really shining through, brighter than the sun.

    Nuclear decay rates are not simply isolated arbitrary numbers unrelated to other phenomena in nature. Nuclear decay rates depend on basic constants of nature: the strength of the strong force between quarks and gluons, the strength of the electrical force between quarks, the strength of the weak nuclear force, the masses of the up and down quarks, etc.

    Alter some of those fundamental constants and you will not simply uniformly speed up nuclear decay rates. You will alter different decay rates in different ways. More than that, you will really screw up various other processes in nature: energy production in stars, atomic spectra, even chemistry itself.

    We would see that. Astronomers see spectra from stars from millions, even billions, of years ago. If nature behaved differently, the spectra would be weird,. They are not.

    Similarly for rocks and fossils from the distant past.

    Look: creationists think that the different phenomena of nature are just separate, disconnected matters and that they can fiddle with them as they wish to fit their crackpot theories.

    That betrays an almost unbelievable ignorance of science. The world does not work that way. The marvel of science is that so many different phenomena are explained by such a tiny number of basic physical laws.

    I know you will not believe me. All that indicates is your failure to acquire any understanding of the current human knowledge of the natural world.

    That is your fault, not mine.

    • Replies: @R2b
  173. @Sean

    I agree that ferrets have long been, and continue to be used widely as laboratory animal model species in studies of human airway physiology, immunology, and respiratory disease susceptibility.

    These small domesticated members of weasel family are closer to man, evolutionarily speaking, than are rodents or rabbits , and are easier to handle and more economical to house/raise, and quicker to reproduce than many other species like primates, other carnivora ie., cats, dogs (ethically and emotionally objectionable to experiment on) or omnivorous (ie., pigs [also can exchange many respiratory viruses readily with humans] species.

    I would imagine that ferrets probably have been used widely in the past (1950’s-1990’s ) in GoF type military BW applications R&D, but since the great acceleration of genetics knowledge and gene analysis/manipulation technologies in biology from the mid ’90’s, more direct ways of shifting a disease organism’s phenotype through direct manipulation of the genetic backbone have probably largely supplanted the ‘Old school’, serial passage in animal-based selective mutation pressure methods to change the virulence and host specificity/infectiousness of a potential BW candidate.

    • Replies: @Sean
  174. @Ron Unz

    Ron Unz wrote to me:

    You and your wife obviously have strong scientific backgrounds, and I’m very glad you’ve taken the time to rebut some of the Intelligent Design nonsense unfortunately promoted in this article. However, I think you should take a much more careful look at the Covid origins issue.
    [snip]
    Instead, as I’ve been pointing out for more than a year now, there’s actually strong perhaps even overwhelming evidence that the global epidemic was the (unintended) result of an American biowarfare attack against China (and Iran). I strongly suggest that you take the the time to carefully consider the two most recent articles in my series:

    Hi Ron! First, thanks for running this website and allowing open discussions (even if I find some of the discussants a bit irritating — the solution to bad speech is more speech), and sorry for my delay in replying.

    I have not had time to digest your posts on Covid, largely because I have been preoccupied with working with the federal investigation into the felonies committed against my daughter by criminals in the UCLA Administration.

    However, my wife has had a chance to read over your posts and thinks you raise some interesting points.

    It is of course extremely hard to be sure on Covid. Natural origin is not impossible, though I have always thought Ockham’s razor favored a lab leak. We need more data of course, which we may never get.

    I’ll try to digest your posts when I get a break from working with the federal investigation.

    Dave Miller in Sacramento

    • Replies: @Sean
    , @Mulga Mumblebrain
  175. @Kevin Barrett

    Kevin Barrett wrote to me:

    Find me a book or article by a good science writer (not a specialist in a technical journal) who can write as well as Meyer and who attempts to refute him.

    Ah. Kev!

    You seem to be intentionally obtuse as to what scientists can or should do.

    The three clowns whom you chose to cite went on at length, their only serious point, about the fact that if evolution created a protein de novo out of a random sequence of amino acids, then, statistically, that protein would be unlikely to be biologically useful.

    But, as I have explained again and again and again, that is not what evolution does. How on earth could it? No, what evolution does is take existing functional proteins and tweak them somehow: SNPs, recombination, etc.

    They did the wrong calculation.
    They calculated something that no one in fact claims is happening.

    Anyone with even a middle-school understanding of math and science can grasp this. I even think you are intelligent enough to grasp this, though I am beginning to have very serious doubts.

    Once it has been shown that their main argument is a simple, trivial error, there is no need or reason to take them seriously at all, to try to further refute them, to write articles or books about them, or anything else.

    If someone’s basic argument is that 2+2=22, after that point you just turn him off.

    Can you grasp this?

    You ask for someone “who can write as well as Meyer”? Who cares? Yes, con men are often very smooth and articulate. But if a con man claims that 2+2=22, he is still a con man, no matter how well he speaks or writes.

    Look: as I have said before, scientists are deluged with crack-pots like Meyer making obviously false claims about science. There is literally not enough time in all of our lives to refute them.

    And it does no good anyway. I have conclusively refuted Meyer: he made the wrong calculation.

    But that is not enough for you crack-pots. You think I owe you more. You think one of us scientists should write a whole book to point out that Meyer made the wrong calculation. (No one would buy the book anyway, and it would just raise Meyer’s stature: a real scientist would have taken him seriously. At last.)

    And that would not suffice either. You would just claim that Meyer wrote better than we did or that you found him more convincing.

    Most of us scientists learned long ago that this is a sucker’s game: crack-pots like you set up the game so that no matter how conclusive the information we present, you claim that we lose unless and until you declare yourself convinced, no matter how incredibly ignorant or stupid you may be.

    If we play along, we are stuck to the proverbial tar-baby.

    I have suggested to you both an online paper, that has further references and that explicitly alludes to the clown Meyer, as well as Andreas Wagner’s recent book.

    And, most importantly, I have presented a simple explanation, comprehensible even to a moderately bright middle-school student, that the clowns did the wrong calculation.

    This is a test of your integrity and your intelligence, Kev. Can you honestly tell everyone here that you cannot understand how the point I have made is conclusive against the clowns?

    Because, if you cannot, that tells everyone whether they should ever take anything you say seriously. At all.

    • Replies: @Tochter
  176. Sean says:
    @PhysicistDave

    Dave, I have little bit of knowledge of what goes on behind the scenes in criminal prosecution from acquaintances who despite involvement escaped prosecution and others who beat charges, serious ones, at a trial. Please consider whether you really ought to continue talking about this here; I think you have sent a message, but risk giving their expensive very well connected lawyers something to work with.

    • Replies: @PhysicistDave
  177. @PhysicistDave

    Your comments were more on-topic than my question, on the whole. I was not referring to them, but to a particular sentence with science glorification which our current situation hardly allows. I will rephrase and insist:

    How about debating whether we would have pandemic-generating lab incidents without you scientists?

    • Replies: @PhysicistDave
  178. Sean says:
    @ghost of q.mensch

    ‘GoF type military BW applications’ are not separable from standard virology techniques being employed recklessly as to whether life would be endangered. Chinese are one dimensionally focused, because in China competition is cruel and no one wants to be one of those eating ratmeat

    https://www.kirkusreviews.com/book-reviews/andreas-wagner/life-finds-a-way/

    Most readers associate evolution with Darwinian natural selection, but Wagner points out its limited creative capacity. In natural selection, a better adapted organism produces more offspring. This preserves good traits and discards bad ones until it reaches a peak of fitness. This process works perfectly in an “adaptive landscape” with a single peak, but it fails when there are many—and higher—peaks. Conquering the highest—true creativity—requires descending into a valley and trying again. Natural selection never chooses the worse over the better, so it can’t descend. Wagner devotes most of his book to the 20th-century discovery of the sources of true biological creativity: genetic drift, recombination, and other processes that inject diversity into the evolutionary process

    The Chinese system penalizes failure and so everyone goes balls to the wall. People under pressure make mistakes, or haven’t the luxury of stopping to wonder if they might be making one and that is what happened with the Wuhan levels four biosafety lab that the French built in Wuhan. All the Chinse wanted to show what they could do with this facility without the French, and having collected 15,000 samples from wild bat they found some coronaviruses with a bit of ability to infect humans and looking for the big showy success in international science, they serially passaged it through humanized animals or cell cultures and produced what might as well have been a bioweapon. Then they failed to contain it.

    • Troll: d dan
  179. @Sean

    Sean wrote to me:

    Please consider whether you really ought to continue talking about this here; I think you have sent a message, but risk giving their expensive very well connected lawyers something to work with.

    Sean, thanks for your advice, but the police have never accused my daughter of any crimes: they acknowledged that she was the victim in their reports (the criminal actually freely confessed to the police to multiple violent crimes against my daughter!).

    The problem is the criminals in the administration at UCLA who are punishing my daughter through internal University procedures because my daughter reported violations of federal law going on at UCLA.

    How do we got them prosecuted and sent to jail for the rest of their lives (ten years for each count of their retaliation against my daughter under 18 USC 241)?

    Lawyers have not been helpful in helping us nail these thugs: UCLA has a very long record of covering up crimes by their staff.

    It’s become clear that going to the news media is the only way to expose the criminals who control UCLA. That is the only thing that stopped these thugs in the past and it is clearly the only real option my daughter has. In the past, once the media became aware, then, finally, prosecutors went after the UCLA thugs.

    We want them publicly exposed and then, finally, in prison jumpsuits. Let orange be the new UCLA color.

    We have extensive documents in their own words proving their criminal behavior beyond any sane doubt. We are going to release them to the world.

  180. @Brás Cubas

    Brás Cubas wrote to me:

    How about debating whether we would have pandemic-generating lab incidents without you scientists?

    Scientists are not a cohesive social group. Neither I nor my wife have any more influence over what Tony Fauci funds than you do.

    For what it is worth, most of the scientists I have heard opine on the subject are appalled that Fauci funded gain of function research. But we have no say.

    It’s under the control of politicians, not scientists.

    • Replies: @anon
    , @Brás Cubas
  181. anon[184] • Disclaimer says:
    @PhysicistDave

    …we have no say. It’s under the control of politicians, not scientists.

    Rubbish.

    Edward Teller, ARPA/DARPA.
    When psycho-scientists become politicians.

    Show me the twisted arms.

    90% of scientists, PhDs belong in Guantanamo.

    bjondo

  182. Tochter says:
    @PhysicistDave

    Dave, you come off as a supremely supercilious and mean-spirited man, and that weakens your arguments. Your constant harping on the low intelligence of your critics rings false. You are psychologically incapable of seeing that it is not a lack of intelligence that leads them to disagree with you. The more you call them stupid, the more stupid you appear. They disagree with you because they sense that something doesn’t add up here, regardless of the errors in this one specific niggling argument about proteins, and they also sense that something is wrong with you as a man. We live in a world in which essentially every expert of your ilk in history, which is to say the experts of the arrogant, autistic sort, has been proven wrong at some point despite all of the magic numbers and letters they had at their disposal. What all of these experts had in common was a fatal certitude that this time, they knew the truth. You may be right about the issue at hand, but your style of thinking and arguing shows a dangerous level of hubris as well as a fundamentally brittle and juvenile vision of life. The problem with the type of intelligence you appear to prize – the ability to juggle and articulate abstract symbols – is that it always risks losing its connection with the big picture. The people who read Unz are people who have seen the Big Lie in action. They have been astounded and humbled by the paradox of a mountain of evidence that looks unassailable when seen through a microscope revealing itself to be nothing but smoke when they step back and survey the big picture. They have been spooked by the experience and no longer trust anyone on credentials alone. There are a lot of Big Lies out there, and what they all have in common is that they are always protected by phalanxes of petty experts whose autistic focus on details, like the fact that the three “clowns” made the wrong calculation here, makes them perfect dupes of the larger lie. I am not saying that you are such a dupe, but you certainly appear to have the psychology and demeanor of one. No one here has time to become an expert in every field, so we must rely on our capacity to judge a man’s character by his rhetoric to distinguish between those who protect a Big Lie, either as dupes or as agents, and those who do not. You fail the smell test.

    • Agree: PhysicistDave
    • Replies: @PhysicistDave
  183. nebulafox says:
    @PhysicistDave

    James Clerk Maxwell did not believe in evolution. That does not mean his laws of electromagnetism are wrong. But it does mean that he was probably no biology expert.

    Being a genius in one field doesn’t automatically give you authority in others. One of the big problems in modern America is that we’ve confused niche expertise with administrative competence or even just basic character, hence, well, Fauci and his crew.

    • Agree: PhysicistDave
    • Replies: @anon
  184. @PhysicistDave

    It’s good to know that you side with the good guys. In fact, the world needs the greatest number of scientists’ opinions it can muster to fight advocates of dangerous research. In view of that, and of the fact that I am not sure I was being reasonable, I will stop provoking you.

    • Replies: @PhysicistDave
  185. skrik says:
    @bayviking

    3rd attempt, no reportable success:

    I found the ENaC-α sequence here:

    https://www.ncbi.nlm.nih.gov/nuccore/NM_001038.6

    “Homo sapiens sodium channel epithelial 1 subunit alpha (SCNN1A), transcript variant 1, mRNA”

    Looking down to /translation=”, one can find RRARS; so far so good. Its ‘position’ in the sequence is 201, i.e. after 200 units. Then, looking down to “ORIGIN,” one can locate position 200 * 3 + 1 = 601 and find:

    601 aatacagctc cttcacca – which looks nothing like what we expect, namely:

    CTCCTCGGCGGGCACGTAGT [a bit longer than Deigin’s CT CCTCGGCGGG]

    Sorry; my amateur bumbling has hit an ignominious roadblock.

    Two ‘buts’ for now; recall that ‘natural’ recombination can only occur in cells infected with two (or more) viruses, in order for the [prohibited import from Malaysia] pangolin-CoV RBM to meet up with some [remote Chinese] bat-CoV spike, some animal has to a) be infected with both CoVs, b) survive long enough to c) pass the ‘product’ on and so [continuously] on, until d) the bug hops zoonotically over to some human patient-0, AND I don’t know at all, how the PRRA could hop from ENaC-α [assuming it could actually be a source] into some [bat/pangolin/other?] CoV-2 progenitor spike. rgds

    • Replies: @Sparkon
  186. @Brás Cubas

    Brás Cubas wrote to me:

    I am not sure I was being reasonable, I will stop provoking you.

    Oh, it’s okay to provoke me: I’m a big boy, I can take it.

    Seriously, I don’t mind people criticizing scientists. Of course, some scientists are indeed scum, as in any profession: I could name quite a few myself.

    On balance, I would say that scientists are a bit more honest than lawyers, but probably, on average, a bit less honest than librarians (I’ve only known one crooked librarian, but several crooked scientists).

    Needless to say, the more closely tied a scientist is to the government, the more one has to be skeptical. Our government is not run by people with any significant sense of integrity.

    • Thanks: Brás Cubas
  187. @Tochter

    Tochter wrote to me:

    Dave, you come off as a supremely supercilious and mean-spirited man…

    Oh, you are so, so right. I’m badder than old King Kong, meaner than a junkyard dog.

    Sing along with me:

    Bad, Bad PhysicistDave
    Baddest man in the whole darn town
    Badder than old King Kong
    Meaner than a junkyard dog.

    My dad loved that song!

    But still what the clowns said in the video is an obvious falsehood, obvious even to a normal middle-school student (but of course not to you or Kevin!).

    By the way, are you acquainted with the concept of “paragraphs”?

    Eppur si muove.

  188. R2b says:
    @PhysicistDave

    Of course you have study phenomena separetly.
    There is no other way.
    Afterwards you can compose a bigger picture, if so possible.

    By bringning in that gluon, you expose yourself as a, well what shall I say, some science high-priest.

    We have basics here, you can not account for.
    You do not know the composite of the material, as per beginning.
    Thats just a fact.

    And as I say, which you don’t adress, uniformitarianism is at the base of what you and common darwinism rely upon.

    To be honest, do you really know what you’re talking about?

    • Replies: @PhysicistDave
  189. Sean says:
    @skrik

    The workerswere clearing and thus breathinf in vast amounts of bat excrement, so this was a disease humans could catch, but not one that was transmissible human to human. The question is whether the samples that the Wuhan virology institute admit to having of bat coronavirus that could cause disease in humans were serially passaged through humanised mice or cell cultures, which is a dual purpose technique that both ordinary virology and and germ warfare use. The Covod-19 pathogen is in its own clade which is consistent with serial passage.

    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7435492/
    {T]he artificial generations added by forced serial passage creates the artificial appearance of evolutionary distance… and is exactly what is found with SARS‐CoV‐2, which is distant enough from any other virus that it has been placed in its own clade. […] And just like influenza viruses are only able to preserve their furin cleavages in artificial environments since the heightened virulence they impart kills their hosts before they can propagate in a natural setting, based on the known taxonomy lineage B coronaviruses do not appear to be able to support furin cleavages in nature. […] SARS‐CoV‐2 may have gained its furin cleavage site the same way influenza viruses do—through the in vivo serial passage between the live hosts

    Simon Wain-Hobson compared it to ruthless selection of alleles in wolves to breed dachshunds on the pretext that this was anticipating something that nature was going to do. Wain-Hobson also said in of the Ralph Baric/ Wuhan Virology Institute coronavirus experiments in 2015 that no one could predict the trajectory if their manufactured virus escaped. There was a ban on the research, but in 2017 Fauci lifted it and gave the work to the Wuhan Virology Institute, which is the only place in China equipped to do coronavirus gain of function research. Low and behold Wuhan is where an incredibly transmissible coronavirus pandemic started. Multiple lines of evidence converge on a lab leak in Wuhan or a bioweapon attack deliberately made to like a Wuhan lab leak.

    • Replies: @Mulga Mumblebrain
    , @skrik
  190. Sparkon says:
    @skrik

    recall that ‘natural’ recombination can only occur in cells infected with two (or more) viruses

    That’s what I proposed in my comment #153.

    Some poor sap somehow got infected with coronaviruses from both bats and pangolins, perhaps without much in the way of symptoms. He or she was a human incubator for SARS-CoV-2, and either traveled to Wuhan himself, or subsequently passed it on to villagers, one or more of whom traveled to Wuhan.

    Indeed it may be a remote possibility, but can anyone absolutely rule it out? I don’t think so.

    • Replies: @Sean
  191. anon[253] • Disclaimer says:
    @nebulafox

    James Clerk Maxwell did not believe in evolution…But it does mean that he was probably no biology expert

    Just asking:

    Do biology experts know how first life happened?
    Is there evolution/nat selection from non life?

    Maxwell probably had a touch of common sense.

    Just guessing.

    bjondo

    • Replies: @Sean
    , @PhysicistDave
  192. @R2b

    R2b wrote to me:

    To be honest, do you really know what you’re talking about?

    Yes, but you don’t.

    I actually analyzed raw data to do radiometric dating when I was at Caltech.

    The silly guy also wrote to me:

    Of course you have study phenomena separetly [sic].
    There is no other way.
    Afterwards you can compose a bigger picture, if so possible.

    There is another way. It is called “science,” something you know nothing about.

    What makes, say, Einstein’s General Theory of Relativity so successful is that it simultaneously explains multiple disparate phenomena: gravitational time dilation, the precession of the perihelion of Mercury, the bending of light by the Sun, etc.

    I could go on and on about this — the atomic theory, evolution, the geological time scale, stellar structure theory — I could write a book about it (in fact, I am).

    But you are so ignorant of science that you really think, “Of course you have study phenomena separetly. [sic]”

    The silly guy also wrote:

    By bringning in that gluon, you expose yourself as a, well what shall I say, some science high-priest.

    “High-priest”?? Merely “high-priest”?

    No: physics is God and I am its prophet!

    Repeat after me the profession of faith:

    There is no God but Physics and PhysicistDave is its Prophet!

    Seriously, I did my Ph.D. at Stanford in elementary-particle physics, so, yes, I really truly am an expert on quarks, gluons, leptons, gauge bosons, etc.

    Now I have figured out from past experiences with guys like you that it is unimaginable to you that a bright, well-education person would ever even speak to a guy… well, a guy like you.

    And you do have a point. Smart people do despise guys like you.

    But, hey, sometimes we just go slumming.

    R2b also wrote:

    We have basics here, you can not account for.
    You do not know the composite of the material, as per beginning.
    Thats just a fact.

    Well… as I tried to explain earlier, we actually know a lot about how those “basics” lead to complex phenomena. And you just cannot change those basics to arbitrarily speed up radioactive decay without making a lot of things go blooey, to use a term you might grasp.

    I know this is all beyond you and that I have stretched your brain beyond the breaking point.

    Go watch some Road Runner cartoons: I hear it helps.

    • Replies: @R2b
    , @Bumpkin
    , @R2b
  193. Sean says:
    @Sparkon

    Pangolins are now thought to have been not a factor in the Covid 19 pathogen becoming so nasty.

    Some poor sap somehow got infected with coronaviruses from both bats and pangolins, perhaps without much in the way of symptoms.

    You do know that the Wuhan Institute of Virology were going on trips to remote bat caves and bringing samples of bat coronaviruses back to Wuhan, don’t you?

    [A]nd either traveled to Wuhan himself, or subsequently passed it on to villagers, one or more of whom traveled to Wuhan.

    Wuhan is a thousand kilometers from the abandoned mine where the workers got sick after clearing bat guano. The Wuhan institute of virology had 15,000 samples of bats and a lab colony of actual live bats, because their research centered on how to find a potential pandemic virus. Guess what? They found one.

    Gain of function need not have been done on the virus for the virus to have come from Wuhan Institute of Virology. Someone from that institute could have become patient zero on trips to sample bats at places like the abandoned mine. Or someone could have been infected inside the lab while working with live bats, or concentrated solutions of ordinary bat coronaviruses. To say as Robert Garry does (see here for paper) that the Covid -19 virus had no GOF performed on it, so it was never in a lab is silly. Does not follow.

    If you wake up and there is snow on the ground outside that is excellent circumstantial evidence that it fell from the sky during the night. The pandemics starting within 9 miles of the only place in China (big place) equipped for doing this bat coronavirus work, yet hundreds of miles from the closest known relative of the Covid-19 coronavirus is most unlikely to be a coincidence. Quite possibly the Covid-19 pathogen was not designed, but that does not entail that the pandemic starting close to the Wuhan Institute of Virology is random. Why did they not just leave the bats in peace in their remote caves?

    • Replies: @skrik
    , @skrik
    , @ivan
  194. @Sean

    So, in your opinion, there is no chance that US researchers, say at the UNC at Chapel Hill, could have had the bat virus in question. How so? And if they did, I would bet a penny to a pound that it was used in bio-weapons’ research, somewhere in the gigantic US bio-warfare establishment, simply because it could be laid at China’s door, by Sinophobe racists bent on ‘…bringing China down’.

  195. @Sean

    Your filthy, pig ignorant, Orientalist racism is nauseating-and so very ‘Exceptional’. The sheer hatred and racialist contempt of so many US thugs when speaking of the Chinese is one of the reasons that I am convinced that the USA’s intentions towards China are genocidal.

    • Replies: @Sean
  196. skrik says:
    @Sean

    [@Sean says:]

    {New details on COVID origins and Wuhan lab l GMA
    64,868 views
    •14 Jun 2021
    946
    144
    Share
    Save
    Good Morning America
    3.33M subscribers
    Terry Moran reports on what lead researchers are learning about COVID-19 while studying inside the Wuhan Institute of Virology.}

    [MORE]

    Next, owner:

    {The Walt Disney Company
    Company Overview: The Walt Disney Company owns the ABC television network; cable networks including ESPN, the Disney Channel, SOAPnet, A&E and Lifetime; 277 radio stations, music- and book-publishing companies; film-production companies Touchstone, Miramax and Walt Disney Pictures; Pixar Animation Studios; the cellular ..}

    Me: The lamestream media aka the US/Z-MMH = corrupt&venal Media (aka press, radio + TV, incl. PFBCs = publicly financed broadcasters), Madison Ave., Hollywood etc..

    The lamestream media mostly pushes the ‘establishment narrative,’ usually the truth may be 180° from that narrative, a proof = Operation Mockingbird. Effectively this GMA video is just as bad as that above from Sky News Australia.

    Conclusion on video: Propaganda, mostly totally unfounded; anybody citing such rubbish damages any credibility they may claim.

    Yes, there is the Master’s thesis and yes, 6 sick, 3 dead – IF the thesis is true.

    @Sean says: “so this was a disease humans could catch, but not one that was transmissible human to human” AFAIK, there is no evidence that what the miners had was or was not contagious. But again AFAIK, nobody disputes that WIV was fully into GoF; it was known to be part of their ‘contract’ with EcoHealth, paid for by the US.

    @Sean says: “lines of evidence converge on a lab leak in Wuhan or a bioweapon attack deliberately made to [look sic] like a Wuhan lab leak” Me: Agreed. Last but: As I said above, sledging WIV is totally beside the point; they may well have built a gun, but Q: Who put the ‘bullet’ [PRRA polybasic furin cleavage site] in, who ‘pulled the trigger’ = deliberate release? A: Perhaps only ‘the Shadow knows,’ but I’d back an horse with form [tip: Some rogue-operator high enough up within a rogue-regime]. rgds

  197. @PhysicistDave

    May I suggest that you peruse information regarding the USA’s collaboration with Shiro Ishii et al, of Unit 731 biological warfare and experimentation (including live dissection, ie vivisection of victims including children)after WW2, and the transfer of Unit 731’s ‘research’ to US authorities?

  198. Sean says:
    @anon

    Intelligent design is really about how people as intelligent as James Clerk (his real family name) evolved. It seems to be that human society reached a point where it began to select for them, How? By the superior reproductive success over generations of literate people and scribes. In other words … clerks.

    https://www.psychologytoday.com/gb/blog/the-imprinted-brain/201201/evolutionary-paradise-lost-don-t-adam-and-eve-it
    Because the modern world is so different from our original environment, evolution has only marginal relevance today (so no need to take it seriously in a modern context).

    But something must be wrong here because the ultimate factor in evolution is reproductive success. Genes which promote the reproductive success of their carriers are by definition selected and those that don’t, aren’t. It’s as simple as that. So how come human numbers have vastly increased since paradise was lost? Why have we evolved to become the dominant species on the planet? And why is human health, wealth, and longevity remorselessly increasing? And most of all in the industrialized world, definitely not in Africa!

  199. R2b says:

    Well that was a lot of condescending and woid of facts.
    First you brag about the ”glue”, that is theorethical physics.
    Then you steer in on Einstein, und so veiter.

    Ok, you have read some figures at Stanford, so what?
    Cathastrophe theory is back i evolutionary circles.
    A lot of ”unbelieving” scientists are questioning Uniformitarianism.

    You are a person impossible to reason with, or even debate.
    One wonders if you can come up with any facts relating properly, of if you are searching for another package of item-dropping, dispersed with insults?

    You know, science can’t really do anything relating to first things, like in this case. And counter your assertions, there are a load of good interpretations to given facts – not theorethical fanasies the CERN-bunch are purporting.

  200. skrik says:
    @Sean

    The pandemics starting within 9 miles of the only place in China (big place) equipped for doing this bat coronavirus work, yet hundreds of miles from the closest known relative of the Covid-19 coronavirus is most unlikely to be a coincidence

    Me: Agree, but if some ‘black-hats’ set out to frame WIV/China, where else would they release their ‘bio-bombshell?’

    Quite possibly the Covid-19 pathogen was not designed

    Me: You [not alone, but all such no-hear, no-sees] seem to continually ignore the pangolin-connection, in the RBM within the RBD [if you still need to, you could ask Mr. Google what RBD/RBM means via the ‘define:’ function.] Your next task is to consider the PRRA insertion, from whence it came? By Whom? My tip: Fort Detrick or some analog, and when = *after* the EVALI tests but then just *before* release *near to but not in* the wet-market near WIV. This would well-explain the cut-snake-like reaction of the Chinese to contain COVID-19 to within Wuhan; When WIV decoded the PRRA, they instantly recognised that they were under a *deadly-earnest* bio-warfare-attack.

    but that does not entail that the pandemic starting close to the Wuhan Institute of Virology is random

    Me: How many times? See ‘black-hats’ above.

    Why did they not just leave the bats in peace in their remote caves?

    I suggest that you direct this Q to your fellow hasbarat/covert operators. rgds

    • Replies: @Sean
  201. Sean says:
    @skrik

    A few years ago the US defence dept suggested it might use thermonuclear weapons in response to a sufficiently damaging cyber attack: a computer virus! China has several hundred nuclear weapons; had China agreed that it would not start a war with escalation up to and including nuclear weapons use in retaliation for a bioweapon attack? China is no Iran, which can be assailed with impunity. China could hit back very hard indeed, and it certainly would do so if it thought for one second the US had attacked with a bioweapon. If a bioweapon was used, it would be one that lacks anything discernably unnatural about it. Russia almost attacked the US because of a Norwegian weather probe. It simply is not in contact with reality to think that such an attack as you are suggesting would be launched without plausible deniability. A D for dunce hat for for thinking otherwise.

    Facebook was treating mention of the lab leak theory as ‘Fake News’. The alternative voices who are in accord with the centi billionaires of social media in thinking China has a better model are another group requiring such headgear. China has been exposed as incredibly incompetent, and the elite are depending on China for future profits, hence the lab leak story was suppressed. The so called alternative thinkers were castigating America as ran by malevolent elite so impure and incapable its ‘Empire’ was collapsing, and so all those critiquing their homeland by holding China up as a paragon of virtue are angry, tired and emotional that it has been exposed as a land of benighted one party rule inefficiency; far inferior to the Western democratic system with its problem solver democratic values and emphasis on the individual. In addition to Martin Rees bet with Pinker, a prestigious publication pointed out the probability of a bat coronavirus lab leak in detail.

    https://thebulletin.org/2012/08/the-unacceptable-risks-of-a-man-made-pandemic/
    The unacceptable risks of a man-made pandemic
    By Lynn C. Klotz, Edward J. Sylvester | August 7, 2012

    The third is severe acute respiratory syndrome, or SARS, a newcomer that proved how lethal it could be in one natural outbreak during 2002 and 2003, when it killed 9.6 percent of those it infected, a fatality rate almost four times higher than the 1918 flu’s. […]

    In stark contrast to the strict controls on smallpox research, however, SARS, the 1918 flu virus, and potentially human-contagious H5N1 bird flu are studied in laboratories throughout the world, using less than the highest biocontainment, known as Biosafety Level 4, or BSL-4, and there is no approved and stockpiled vaccine for any of them. […] Simply moving all SARS research to BSL-4 facilities will not substantially reduce the risk; there have already been three escapes from BSL-4 containment since 1990: a Marburg virus laboratory-acquired infection at the Vector facility in the Soviet Union in 1990, a foot and mouth disease virus escape from the Pirbright facility in England, and a SARS virus laboratory-acquired infection from a BSL-4-rated biosafety cabinet in a Taiwan laboratory.

    Simon Wade-Hobson was publicly raising concerns about this in 2011, and he got a bit of a ban, in the West. See that is the problem when you do international ‘cooperation’ with China, you end up relying on them and they are useless at the things that really matter. This affair has been a harbinger of how the world will end, if China is trusted with Western technology that might lead to super intelligent AI, ECT.

    • Agree: Johnny Rico
    • Replies: @Mulga Mumblebrain
  202. anon[266] • Disclaimer says:

    god designed evolution

    WIV used it to design this virus

    they literally used darwinian methods to make this virus

    this is the problem with creationists- they cannot understand how evolution can create

  203. skrik says:
    @Sean

    Pangolins are now thought to have been not a factor in the Covid 19 pathogen becoming so nasty

    IMHO, total BS. Kindly try this:

    Analysis of the receptor binding motif (RBM), a portion of the receptor binding domain (RBD) that makes contact with ACE2 (Li et al., 2005a ), revealed that most amino acid residues essential for ACE2 binding by SARS-S were conserved in SARS-2-S (Figure 2B)

    The RBM in SARS-CoV-2 is from the [Guangdong border illegal-import intercepted] CoV-sick pangolin as registered in MP789.

    As a ‘bonus,’ you could try this:

    “The key to understanding SARS-CoV-2’s higher infectivity may lie in its host receptor recognition mechanism. This is because experiments show that the human ACE2 protein, which serves as the primary receptor for both CoVs, binds to CoV-2’s spike protein 5-20 fold stronger than SARS-CoV’s spike protein”

    I suggest that the “5-20 fold stronger” binding may well be due to a) the MP789 RBM and b) the PRRA insert.

    China could hit back very hard indeed, and it certainly would do so if it thought for one second the US had attacked with a bioweapon

    Wait up. rgds

  204. Bumpkin says:
    @PhysicistDave

    I could write a book about it (in fact, I am)

    What is the book going to be about exactly? Are you putting the draft chapters up online somewhere?

    I recommend this to every writer I’ve talked to, to get early feedback from your potential audience. Just open a blog or Substack/ghost and start slapping pages online as you write them. There is no downside to it- you could require registration or a paywall if you prefer- and significant potential upside, ie possibly many more editors and proofreaders for your writing.

    • Replies: @R2b
  205. @anon

    anon[253] asked:

    Do biology experts know how first life happened?

    They have some plausible ideas.

    Of course, obviously it is infinitesimally unlikely that the first cell would have been fossilized!

    Demanding that scientists can give all of the details of the origin of life is a bit like asking you to recite your family tree for the last 10,000 years. If you claim you can do that, you are lying.

    Similarly, if scientists are correct that life arose from abiotic materials, it follows that the physical evidence of that is no longer around (in simple terms, it got eaten!).

    anon also asked:

    Is there evolution/nat selection from non life?

    Yes and no. Obviously, non-life did not demonstrate Mendelian inheritance. On the other hand, some combinations of chemicals would have been more likely to survive and replicate than others, just as we see in crystal growth.

    Part of the problem you anti-scientists have is that you think there are essentialist differences in the real world that simply do not exist. Are viruses really alive or not? Not a question that has or needs an answer. When you die, some biological processes will continue in some of your cells for a while. So… are you really dead? What if we keep some of your cells living in an eternal line of descendants, such as the HeLa cell line?

    Semantic paradoxes like that are not relevant to the reality of the natural world.

    People who think that such issues are real are, quite literally, out of touch with reality.

    That is why I keep stressing that all of the verbalist cultures that preceded the Scientific Revolution, whether Scholasticism/Aristotelianism in the West, or other pre-modern systems of metaphysics in the East, have no future. An extreme example of this is the silliness posted by our friend Intelligent Dasein (one hopes he is joking!).

    And our current parasitic verbalist overclass is another example, an example that may indeed destroy the United States of America. They think that by playing word games with words referring to sex they can alter reality.

    But biology does not change because of their word games.

    A spectre is haunting the hitherto existing cultures of humanity: natural science. And it will destroy them all.

    The third millennium of the Common Era will be dominated by the efforts to accept and absorb the results of natural science. That effort has only just begun.

  206. Anonymous[669] • Disclaimer says:
    @Sean

    https://www.kirkusreviews.com/book-reviews/andreas-wagner/life-finds-a-way/

    Wagner’s work sounds like a popularization of Kimura’s neutral theory of molecular evolution:

    https://en.wikipedia.org/wiki/Neutral_theory_of_molecular_evolution

    I don’t know if it’s true that competition has been more intense in China relative to the West. Part of the reason China’s population is so large is because its peasant base has been able to expand to Malthusian limits. Whereas in the West going back to the original Indo-European conquests you’ve had intense winner-take-all competition and war between military castes and states and more recently in the economic sphere.

  207. Sean says:

    That book is a popular one, but he is an evolutionary theorist in his own right who resolved the neutral–selection debate.

    I got animadverted for saying, but in rural China people are so poor they unashamedly eat rats. The CCP is a tyranny ruling country with a huge wealth gap and no safety net. The person in charge of somewhere like the Wuhan Institute of Virology is going to be a CCP functionary, not a microbiologist. It is a recipe for people being pushed too hard and making mistakes.

  208. R2b says:
    @Bumpkin

    There will be no book, as one can easily concieve from this performance.
    Because he can not now present himself.
    Could be a committé?

    Abiogenesis is the next.
    Impossible to overcome.
    They all start with already exsisting proteins, but never explain where they come from.

    The RATE-project, and Withcomb, Morris, De Young, Boyd and a lot more for all interested, without to strong preconceptions, look it up.

    Beware all truth-loving out there, science falsely so called is roaming and seek to devour what can be swalloved.

  209. ivan says:
    @Sean

    The batshit lady’s justification for disturbing the bats in their caves was that “we have to find them before they find us”. I’d like to ask that silly bint : They’re found us , now what. These Chinese nuts have a big chip on their shoulders about catching up and surpassing the West. I am sure they were out show that they could do gain-of-function research better than the Americans from whom they learned this in the first place.

    • Troll: Mulga Mumblebrain
    • Replies: @Sean
    , @Mulga Mumblebrain
  210. R2b says:
    @PhysicistDave

    Well, you didn’t make your case that good, did you?
    Please present to us all here the book you are knitting together!
    I seriously ponder buying it.

  211. Sean says:
    @ivan

    The media (especially Facebook) treated the idea that China was to blame for the outbreak as fake news, because they thought if it became accepted Trump would be re-elected. Just as Russia can be thought of as a nations of spousal abusers dying of alcoholic poisoning in forth decade, China is a country of a billion bat, rat and snake eating people so a totally natural origin of the Covid-19 pathogen is possible if not actually likely. Indeed, for a decade Professor Ian Lipkin had been annually going over to China at the invitation of their government to advise on prevention of another like outbreak like the SARS one of 2002 which probabally had a natural origin. Still, for all those years Lipkin was begging them to close down their wet markets; they ignored him. So a non engineered virus not from a lab that somehow got 1000 kilometers or so to Wuhan would still be their fault.

    If it was a lab leak on a GoFed or merely sampled virus that was in the Wuhan Institute of Virology the evidence will have been destroyed by now. I think the moral of this episode is that the sort of people eulogised in The Fifth Risk: Undoing Democracy by Michael Lewis actually have the little knowledge that is a dangerous thing in technical matters. Total ignorance is better; had he been asked Trump would not have trusted the Chinese with this research, which the US taxpayer was funding. Trump has been show to be right about China, and the need to disengage from its clammy atentions. That Fauci restarted the gains of function funding for the Wuhan Virology Lab in 2017 despite several years of warning from people who know vastly more than he does about virology such as Simon Wain Hobson. After he 2012 video that emerged of him defending GoF research Fauci’s hasn’t a leg to stand on and is only still there because removing him would be seen as confirming Trumps intuitions.

    Anthony Fauci Says His Critics Are Attacking Science Itself
    “A lot of what you’re seeing as attacks on me quite frankly are attacks on science.”

    Cooperation within a group i relatively hostile to those outside it. Religion is good for getting people to pull together., but that entails conflict between peoples. The scientists think international cooperation is the answer to everything and so do business. The economist is are entranced with global utility and don’t see the nation-state perspective as a legitimate one. Plagues and Peoples a great book by William H. McNeill made clear that Ancient Rome was destroyed by novel epidemics from East after it establish contact with the Chinese Empire which also sufferer from pandemics stemming from the Western disease pool, to which Chinese were immunologically naïve. The political consequences were that Rome and China became xenophobic and cut trade links . But the US elite are in the pockets of those making money from globalisation. So China will go being pampered until it ends the world.

    • Troll: d dan
    • Replies: @Mulga Mumblebrain
  212. nebulafox says:
    @PhysicistDave

    >Are viruses really alive or not? Not a question that has or needs an answer. When you die, some biological processes will continue in some of your cells for a while. So… are you really dead? What if we keep some of your cells living in an eternal line of descendants, such as the HeLa cell line?

    My personal favorite: “What came before the Big Bang?”

    >A spectre is haunting the hitherto existing cultures of humanity: natural science. And it will destroy them all. A spectre is haunting the hitherto existing cultures of humanity: natural science. And it will destroy them all.

    They believed that science would destroy all myths and usher in the end of history in the late 1800s, too. Human beings found more creative ways to be destructive than anybody could have imagined at the time. The technology is coming whether we like it or not. Whether we can learn to handle it wisely as a species without making enough mistakes along the way to send us back to another Dark Ages? I hope we can. Our brains are clearly struggling to deal with the stimuli levels they are receiving. There’s a strong anti-empirical streak in the current environment, and technology is probably making it worse, not matter.

    I personally think that spending more effort doing stuff that’s actually innovative rather than finding the nth-social media app for further crushing whoever powerful people whimsically want crushed that day might help. Maybe. But I could be wrong. A fish rots from the head, and having people in charge who view climate change as something so imminently apocalyptic that it requires CreepyState measures while also insisting that the US can’t have new nuclear plants doesn’t bode well.

  213. @PhysicistDave

    Are viruses really alive or not? Not a question that has or needs an answer.

    Yes, that question does have and needs an answer. The answer is “No.” Viruses are completely stone dead. Being able to answer this is key to understanding what viruses are and how to deal with them.

    When you die, some biological processes will continue in some of your cells for a while. So… are you really dead?

    You’re just begging the question here. What you call “biological processes” are no criterion for determining life or death. A creature is alive for just so long as it is a composition of matter and substantial form. The substantial form is the first act of its existence. When the form is not active, not only is the body not “alive,” it’s not even technically a body. This has nothing to do with cellular chemistry.

    What if we keep some of your cells living in an eternal line of descendants, such as the HeLa cell line?

    Henrietta Lacks is dead. I didn’t think this point was controversial. HeLa cells are no more alive than is a bag of donated blood. Excised tissue is, at best, simply matter suitable educed so as to be capable of incorporation into a body without the need for an additional process of nutrification. It is “predigested food,” so to speak. This would be the case, for example, with an amputated hand that is grafted back on; but HeLa cells are not even that. They are an amputated tumor that would only bring disease to any body that tried to incorporate it.

    All this has been covered before, by me as well as others. You may not be aware that there are answers to your rhetorical questions, but that does not mean that they aren’t there.

  214. @Sean

    Your continued assertions that the Chinese are ‘incompetent’ is pure racist bile. So ‘incompetent’ that they created the greatest economic leap in history, crushed a bio-warfare attack on them, while blow-back in the USA killed 600,000 and are creating their own space station, soon a lunar base, quantum computing, 5G and 6G communications, fusion etc. Nothing is more pathetic than a shit-scared Western racist supremacist spewing imbecilities.

  215. @Sean

    Your genocidal impulses are getting more and more obvious, racist. The world would be so much better without those evil, ‘clammy’, bat, rat and snake-eating untermenschen eh, Adolph. A Final Solution to the Chinese Problem. One would laugh if Evil swill like yours was not so common, and becoming more so, among Western racist thugs.

  216. @ivan

    Oh, look-Sean has a buddy in plotting genocide for those ‘ Chinese nuts’. A pathopsychological epidemic of race hatred has the lower depths of the Western populace foaming at their orifices.

Current Commenter
says:

Leave a Reply - Comments on articles more than two weeks old will be judged much more strictly on quality and tone


 Remember My InformationWhy?
 Email Replies to my Comment
$
Submitted comments have been licensed to The Unz Review and may be republished elsewhere at the sole discretion of the latter
Commenting Disabled While in Translation Mode
Subscribe to This Comment Thread via RSS Subscribe to All Kevin Barrett Comments via RSS
PastClassics
The Shaping Event of Our Modern World
Becker update V1.3.2
Analyzing the History of a Controversial Movement